Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0433383265:

Variant ID: vg0433383265 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33383265
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATTGGTGTTGCTGTGCCGTTCGTAGATACGAAAGGAAGAAATTTAGTATTCTAATATTTATAATTACTTTCTCCGTTTCACAATGTAAGTTATTCTAG[C/T]
ATTTCCCATCTAGACATTCATTAACATCAATATGAATGTGGGAAATGCTAAAATGACTTACATTGTGAAACGGAGAGAGTACTACTTATTGTCATTATTT

Reverse complement sequence

AAATAATGACAATAAGTAGTACTCTCTCCGTTTCACAATGTAAGTCATTTTAGCATTTCCCACATTCATATTGATGTTAATGAATGTCTAGATGGGAAAT[G/A]
CTAGAATAACTTACATTGTGAAACGGAGAAAGTAATTATAAATATTAGAATACTAAATTTCTTCCTTTCGTATCTACGAACGGCACAGCAACACCAATAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.80%	40.80%	8.51%	7.91%	NA
All Indica	2759	70.80%	7.60%	9.93%	11.71%	NA
All Japonica	1512	2.40%	96.80%	0.40%	0.40%	NA
Aus	269	0.40%	66.90%	24.54%	8.18%	NA
Indica I	595	81.30%	5.50%	3.03%	10.08%	NA
Indica II	465	75.50%	2.80%	11.40%	10.32%	NA
Indica III	913	65.00%	11.80%	10.84%	12.38%	NA
Indica Intermediate	786	66.80%	7.00%	13.23%	12.98%	NA
Temperate Japonica	767	0.50%	99.30%	0.00%	0.13%	NA
Tropical Japonica	504	6.30%	93.10%	0.20%	0.40%	NA
Japonica Intermediate	241	0.40%	96.30%	2.07%	1.24%	NA
VI/Aromatic	96	2.10%	29.20%	51.04%	17.71%	NA
Intermediate	90	31.10%	54.40%	7.78%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433383265	C -> DEL	N	N	silent_mutation	Average:47.909; most accessible tissue: Callus, score: 84.032	N	N	N	N
vg0433383265	C -> T	LOC_Os04g56040.1	upstream_gene_variant ; 4860.0bp to feature; MODIFIER	silent_mutation	Average:47.909; most accessible tissue: Callus, score: 84.032	N	N	N	N
vg0433383265	C -> T	LOC_Os04g56050.1	upstream_gene_variant ; 3033.0bp to feature; MODIFIER	silent_mutation	Average:47.909; most accessible tissue: Callus, score: 84.032	N	N	N	N
vg0433383265	C -> T	LOC_Os04g56060.1	upstream_gene_variant ; 3357.0bp to feature; MODIFIER	silent_mutation	Average:47.909; most accessible tissue: Callus, score: 84.032	N	N	N	N
vg0433383265	C -> T	LOC_Os04g56050-LOC_Os04g56060	intergenic_region ; MODIFIER	silent_mutation	Average:47.909; most accessible tissue: Callus, score: 84.032	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433383265	NA	2.37E-08	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433383265	NA	1.07E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433383265	5.55E-07	6.89E-10	mr1707_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433383265	4.22E-07	8.35E-15	mr1728_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251