\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433383265:

Variant ID: vg0433383265 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33383265
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATTGGTGTTGCTGTGCCGTTCGTAGATACGAAAGGAAGAAATTTAGTATTCTAATATTTATAATTACTTTCTCCGTTTCACAATGTAAGTTATTCTAG[C/T]
ATTTCCCATCTAGACATTCATTAACATCAATATGAATGTGGGAAATGCTAAAATGACTTACATTGTGAAACGGAGAGAGTACTACTTATTGTCATTATTT

Reverse complement sequence

AAATAATGACAATAAGTAGTACTCTCTCCGTTTCACAATGTAAGTCATTTTAGCATTTCCCACATTCATATTGATGTTAATGAATGTCTAGATGGGAAAT[G/A]
CTAGAATAACTTACATTGTGAAACGGAGAAAGTAATTATAAATATTAGAATACTAAATTTCTTCCTTTCGTATCTACGAACGGCACAGCAACACCAATAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 40.80% 8.51% 7.91% NA
All Indica  2759 70.80% 7.60% 9.93% 11.71% NA
All Japonica  1512 2.40% 96.80% 0.40% 0.40% NA
Aus  269 0.40% 66.90% 24.54% 8.18% NA
Indica I  595 81.30% 5.50% 3.03% 10.08% NA
Indica II  465 75.50% 2.80% 11.40% 10.32% NA
Indica III  913 65.00% 11.80% 10.84% 12.38% NA
Indica Intermediate  786 66.80% 7.00% 13.23% 12.98% NA
Temperate Japonica  767 0.50% 99.30% 0.00% 0.13% NA
Tropical Japonica  504 6.30% 93.10% 0.20% 0.40% NA
Japonica Intermediate  241 0.40% 96.30% 2.07% 1.24% NA
VI/Aromatic  96 2.10% 29.20% 51.04% 17.71% NA
Intermediate  90 31.10% 54.40% 7.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433383265 C -> DEL N N silent_mutation Average:47.909; most accessible tissue: Callus, score: 84.032 N N N N
vg0433383265 C -> T LOC_Os04g56040.1 upstream_gene_variant ; 4860.0bp to feature; MODIFIER silent_mutation Average:47.909; most accessible tissue: Callus, score: 84.032 N N N N
vg0433383265 C -> T LOC_Os04g56050.1 upstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:47.909; most accessible tissue: Callus, score: 84.032 N N N N
vg0433383265 C -> T LOC_Os04g56060.1 upstream_gene_variant ; 3357.0bp to feature; MODIFIER silent_mutation Average:47.909; most accessible tissue: Callus, score: 84.032 N N N N
vg0433383265 C -> T LOC_Os04g56050-LOC_Os04g56060 intergenic_region ; MODIFIER silent_mutation Average:47.909; most accessible tissue: Callus, score: 84.032 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433383265 NA 2.37E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433383265 NA 1.07E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433383265 5.55E-07 6.89E-10 mr1707_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433383265 4.22E-07 8.35E-15 mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251