Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433369960:

Variant ID: vg0433369960 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33369960
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTACCTTTACCCAATAAATAATTTGCAACTCTGTTCTTACATTGTCCACGTACTCCCTCCGTCCCATAAGGGATTTTGTAGCGCCCGTTCCGTCGTGGCG[C/T]
CTAGCGGAAAAATTATCTCCTAAAAATCCTAATTGCGAAATTTGTTTCTTCGCTTGTCGTCTAGTGTCCGTGCCGTCTCAAGATCTCAAATCCCCGATCT

Reverse complement sequence

AGATCGGGGATTTGAGATCTTGAGACGGCACGGACACTAGACGACAAGCGAAGAAACAAATTTCGCAATTAGGATTTTTAGGAGATAATTTTTCCGCTAG[G/A]
CGCCACGACGGAACGGGCGCTACAAAATCCCTTATGGGACGGAGGGAGTACGTGGACAATGTAAGAACAGAGTTGCAAATTATTTATTGGGTAAAGGTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	2.30%	12.74%	49.96%	NA
All Indica	2759	8.20%	0.10%	16.93%	74.77%	NA
All Japonica	1512	86.90%	6.90%	0.93%	5.29%	NA
Aus	269	18.60%	0.00%	29.00%	52.42%	NA
Indica I	595	7.20%	0.00%	8.07%	84.71%	NA
Indica II	465	3.70%	0.20%	17.20%	78.92%	NA
Indica III	913	11.80%	0.00%	20.04%	68.13%	NA
Indica Intermediate	786	7.40%	0.30%	19.85%	72.52%	NA
Temperate Japonica	767	95.60%	0.40%	0.26%	3.78%	NA
Tropical Japonica	504	72.80%	18.30%	1.39%	7.54%	NA
Japonica Intermediate	241	88.80%	3.70%	2.07%	5.39%	NA
VI/Aromatic	96	16.70%	0.00%	38.54%	44.79%	NA
Intermediate	90	51.10%	4.40%	6.67%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433369960	C -> DEL	N	N	silent_mutation	Average:52.035; most accessible tissue: Minghui63 root, score: 88.313	N	N	N	N
vg0433369960	C -> T	LOC_Os04g56020.1	downstream_gene_variant ; 3781.0bp to feature; MODIFIER	silent_mutation	Average:52.035; most accessible tissue: Minghui63 root, score: 88.313	N	N	N	N
vg0433369960	C -> T	LOC_Os04g56030.1	downstream_gene_variant ; 4375.0bp to feature; MODIFIER	silent_mutation	Average:52.035; most accessible tissue: Minghui63 root, score: 88.313	N	N	N	N
vg0433369960	C -> T	LOC_Os04g56020-LOC_Os04g56030	intergenic_region ; MODIFIER	silent_mutation	Average:52.035; most accessible tissue: Minghui63 root, score: 88.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433369960	NA	4.82E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433369960	NA	4.17E-06	mr1667_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251