\
| Variant ID: vg0433369960 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 33369960 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTACCTTTACCCAATAAATAATTTGCAACTCTGTTCTTACATTGTCCACGTACTCCCTCCGTCCCATAAGGGATTTTGTAGCGCCCGTTCCGTCGTGGCG[C/T]
CTAGCGGAAAAATTATCTCCTAAAAATCCTAATTGCGAAATTTGTTTCTTCGCTTGTCGTCTAGTGTCCGTGCCGTCTCAAGATCTCAAATCCCCGATCT
AGATCGGGGATTTGAGATCTTGAGACGGCACGGACACTAGACGACAAGCGAAGAAACAAATTTCGCAATTAGGATTTTTAGGAGATAATTTTTCCGCTAG[G/A]
CGCCACGACGGAACGGGCGCTACAAAATCCCTTATGGGACGGAGGGAGTACGTGGACAATGTAAGAACAGAGTTGCAAATTATTTATTGGGTAAAGGTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.00% | 2.30% | 12.74% | 49.96% | NA |
| All Indica | 2759 | 8.20% | 0.10% | 16.93% | 74.77% | NA |
| All Japonica | 1512 | 86.90% | 6.90% | 0.93% | 5.29% | NA |
| Aus | 269 | 18.60% | 0.00% | 29.00% | 52.42% | NA |
| Indica I | 595 | 7.20% | 0.00% | 8.07% | 84.71% | NA |
| Indica II | 465 | 3.70% | 0.20% | 17.20% | 78.92% | NA |
| Indica III | 913 | 11.80% | 0.00% | 20.04% | 68.13% | NA |
| Indica Intermediate | 786 | 7.40% | 0.30% | 19.85% | 72.52% | NA |
| Temperate Japonica | 767 | 95.60% | 0.40% | 0.26% | 3.78% | NA |
| Tropical Japonica | 504 | 72.80% | 18.30% | 1.39% | 7.54% | NA |
| Japonica Intermediate | 241 | 88.80% | 3.70% | 2.07% | 5.39% | NA |
| VI/Aromatic | 96 | 16.70% | 0.00% | 38.54% | 44.79% | NA |
| Intermediate | 90 | 51.10% | 4.40% | 6.67% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0433369960 | C -> DEL | N | N | silent_mutation | Average:52.035; most accessible tissue: Minghui63 root, score: 88.313 | N | N | N | N |
| vg0433369960 | C -> T | LOC_Os04g56020.1 | downstream_gene_variant ; 3781.0bp to feature; MODIFIER | silent_mutation | Average:52.035; most accessible tissue: Minghui63 root, score: 88.313 | N | N | N | N |
| vg0433369960 | C -> T | LOC_Os04g56030.1 | downstream_gene_variant ; 4375.0bp to feature; MODIFIER | silent_mutation | Average:52.035; most accessible tissue: Minghui63 root, score: 88.313 | N | N | N | N |
| vg0433369960 | C -> T | LOC_Os04g56020-LOC_Os04g56030 | intergenic_region ; MODIFIER | silent_mutation | Average:52.035; most accessible tissue: Minghui63 root, score: 88.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0433369960 | NA | 4.82E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433369960 | NA | 4.17E-06 | mr1667_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |