\
| Variant ID: vg0433360330 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 33360330 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTATGGGTGTTTGTTGGTAATATAATACATATAAACACGTAAGACGATGTTTATATATATATAGGAGGTCTATTCACTTTGATGTCATTTTTAACATTAT[C/T]
AAATTTTGGTAAAGTTACCAAAAAAAATATCTACATTTAGTTTTCTGTCAAATTTTGGTAATTATCACAAAATTTTGACAATACCAAAATTTAGTAAGGT
ACCTTACTAAATTTTGGTATTGTCAAAATTTTGTGATAATTACCAAAATTTGACAGAAAACTAAATGTAGATATTTTTTTTGGTAACTTTACCAAAATTT[G/A]
ATAATGTTAAAAATGACATCAAAGTGAATAGACCTCCTATATATATATAAACATCGTCTTACGTGTTTATATGTATTATATTACCAACAAACACCCATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 43.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 27.30% | 72.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 17.80% | 82.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 23.70% | 76.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 31.00% | 68.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 32.40% | 67.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0433360330 | C -> T | LOC_Os04g56020.1 | upstream_gene_variant ; 3804.0bp to feature; MODIFIER | silent_mutation | Average:88.728; most accessible tissue: Minghui63 young leaf, score: 93.766 | N | N | N | N |
| vg0433360330 | C -> T | LOC_Os04g56010.1 | downstream_gene_variant ; 289.0bp to feature; MODIFIER | silent_mutation | Average:88.728; most accessible tissue: Minghui63 young leaf, score: 93.766 | N | N | N | N |
| vg0433360330 | C -> T | LOC_Os04g56000-LOC_Os04g56010 | intergenic_region ; MODIFIER | silent_mutation | Average:88.728; most accessible tissue: Minghui63 young leaf, score: 93.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0433360330 | NA | 1.92E-07 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433360330 | NA | 1.15E-06 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433360330 | 5.73E-06 | 1.32E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433360330 | 3.48E-06 | 4.63E-14 | mr1728_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |