\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433360330:

Variant ID: vg0433360330 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33360330
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATGGGTGTTTGTTGGTAATATAATACATATAAACACGTAAGACGATGTTTATATATATATAGGAGGTCTATTCACTTTGATGTCATTTTTAACATTAT[C/T]
AAATTTTGGTAAAGTTACCAAAAAAAATATCTACATTTAGTTTTCTGTCAAATTTTGGTAATTATCACAAAATTTTGACAATACCAAAATTTAGTAAGGT

Reverse complement sequence

ACCTTACTAAATTTTGGTATTGTCAAAATTTTGTGATAATTACCAAAATTTGACAGAAAACTAAATGTAGATATTTTTTTTGGTAACTTTACCAAAATTT[G/A]
ATAATGTTAAAAATGACATCAAAGTGAATAGACCTCCTATATATATATAAACATCGTCTTACGTGTTTATATGTATTATATTACCAACAAACACCCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.80% 0.11% 0.00% NA
All Indica  2759 27.30% 72.50% 0.18% 0.00% NA
All Japonica  1512 97.60% 2.40% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 17.80% 82.20% 0.00% 0.00% NA
Indica II  465 23.70% 76.10% 0.22% 0.00% NA
Indica III  913 31.00% 68.80% 0.22% 0.00% NA
Indica Intermediate  786 32.40% 67.30% 0.25% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 93.70% 6.30% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433360330 C -> T LOC_Os04g56020.1 upstream_gene_variant ; 3804.0bp to feature; MODIFIER silent_mutation Average:88.728; most accessible tissue: Minghui63 young leaf, score: 93.766 N N N N
vg0433360330 C -> T LOC_Os04g56010.1 downstream_gene_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:88.728; most accessible tissue: Minghui63 young leaf, score: 93.766 N N N N
vg0433360330 C -> T LOC_Os04g56000-LOC_Os04g56010 intergenic_region ; MODIFIER silent_mutation Average:88.728; most accessible tissue: Minghui63 young leaf, score: 93.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433360330 NA 1.92E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433360330 NA 1.15E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433360330 5.73E-06 1.32E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433360330 3.48E-06 4.63E-14 mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251