\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433322485:

Variant ID: vg0433322485 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33322485
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGCCTGTTTAGTTGGTGAAATAAAAATATTTGGGTGTCACATCGGACGTTTGACCGAATATCGGAAGGGTTTTCGGACACGAATAAAAAAACTAATTT[T/C]
ATAACTCGCCTGGAAACCGCGAGACGAATCTGTTGAGCCTAATTAAGCCGTCATTAGCACATGTGGGTTAATGTAACACTTATGGCTAATTATGAACTAA

Reverse complement sequence

TTAGTTCATAATTAGCCATAAGTGTTACATTAACCCACATGTGCTAATGACGGCTTAATTAGGCTCAACAGATTCGTCTCGCGGTTTCCAGGCGAGTTAT[A/G]
AAATTAGTTTTTTTATTCGTGTCCGAAAACCCTTCCGATATTCGGTCAAACGTCCGATGTGACACCCAAATATTTTTATTTCACCAACTAAACAGGCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 40.40% 0.08% 0.28% NA
All Indica  2759 84.60% 14.90% 0.07% 0.43% NA
All Japonica  1512 7.30% 92.60% 0.13% 0.00% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 93.30% 6.40% 0.00% 0.34% NA
Indica II  465 95.70% 4.10% 0.00% 0.22% NA
Indica III  913 70.90% 28.50% 0.11% 0.55% NA
Indica Intermediate  786 87.50% 11.80% 0.13% 0.51% NA
Temperate Japonica  767 7.60% 92.20% 0.26% 0.00% NA
Tropical Japonica  504 6.70% 93.30% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433322485 T -> C LOC_Os04g55950.1 upstream_gene_variant ; 2732.0bp to feature; MODIFIER silent_mutation Average:43.47; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0433322485 T -> C LOC_Os04g55940.1 downstream_gene_variant ; 3110.0bp to feature; MODIFIER silent_mutation Average:43.47; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0433322485 T -> C LOC_Os04g55940.2 downstream_gene_variant ; 3110.0bp to feature; MODIFIER silent_mutation Average:43.47; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0433322485 T -> C LOC_Os04g55940-LOC_Os04g55950 intergenic_region ; MODIFIER silent_mutation Average:43.47; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0433322485 T -> DEL N N silent_mutation Average:43.47; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433322485 NA 1.67E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 6.76E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 9.62E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 5.23E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 3.04E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 2.10E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 8.37E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 7.95E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 4.44E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 7.84E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 2.26E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 1.85E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 6.58E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 7.56E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 2.02E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 6.10E-11 mr1681_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 9.59E-06 2.44E-06 mr1681_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 3.18E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 9.10E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433322485 NA 4.22E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251