Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433212260:

Variant ID: vg0433212260 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33212260
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAACTCAATCCGGTACTTGAATATGCTATATGAACTGCACTACAGAAATAAAATGATACACACAGAAATAAAGCATTTTTATTTGCAGGCATATTTGC[G/A]
GAATCAGCATGTTGAACTGCAGCACAGCAAAGCATTTCTGTAGTACAGCAATCAGGCAAATTTGAAGAACAACAATAAAGCAATATGAACTACAAGCAGT

Reverse complement sequence

ACTGCTTGTAGTTCATATTGCTTTATTGTTGTTCTTCAAATTTGCCTGATTGCTGTACTACAGAAATGCTTTGCTGTGCTGCAGTTCAACATGCTGATTC[C/T]
GCAAATATGCCTGCAAATAAAAATGCTTTATTTCTGTGTGTATCATTTTATTTCTGTAGTGCAGTTCATATAGCATATTCAAGTACCGGATTGAGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.80% 0.36% 0.00% NA
All Indica  2759 79.20% 20.30% 0.58% 0.00% NA
All Japonica  1512 15.90% 84.10% 0.00% 0.00% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 92.10% 7.40% 0.50% 0.00% NA
Indica II  465 82.80% 16.80% 0.43% 0.00% NA
Indica III  913 66.30% 33.10% 0.66% 0.00% NA
Indica Intermediate  786 82.20% 17.20% 0.64% 0.00% NA
Temperate Japonica  767 13.40% 86.60% 0.00% 0.00% NA
Tropical Japonica  504 8.10% 91.90% 0.00% 0.00% NA
Japonica Intermediate  241 40.20% 59.80% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433212260 G -> A LOC_Os04g55780.1 downstream_gene_variant ; 4597.0bp to feature; MODIFIER silent_mutation Average:53.062; most accessible tissue: Minghui63 flag leaf, score: 92.245 N N N N
vg0433212260 G -> A LOC_Os04g55800.1 downstream_gene_variant ; 2773.0bp to feature; MODIFIER silent_mutation Average:53.062; most accessible tissue: Minghui63 flag leaf, score: 92.245 N N N N
vg0433212260 G -> A LOC_Os04g55790.1 intron_variant ; MODIFIER silent_mutation Average:53.062; most accessible tissue: Minghui63 flag leaf, score: 92.245 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433212260 G A -0.01 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433212260 NA 6.04E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 NA 4.53E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 NA 2.18E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 NA 1.69E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 3.86E-06 3.86E-06 mr1361 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 NA 1.38E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 NA 7.37E-17 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 NA 6.01E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 NA 4.55E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433212260 NA 2.33E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251