\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433184965:

Variant ID: vg0433184965 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33184965
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCATGTTTTCACTATATTTGTGGTTTGCACTGTATATTTTTCCAGTTATACATGTTATCTTTTTCTTTCTTCAACCAATCTTATGTGGTATTTTTAG[G/A]
GACAACACATGAGCCCTTATAATACTTGCTCTAAGGCAATCTTCTTGCCTTGTGTTAAAAAATAAATTTTTTAAAAAATGACGCCAACACCAAGCCCAAA

Reverse complement sequence

TTTGGGCTTGGTGTTGGCGTCATTTTTTAAAAAATTTATTTTTTAACACAAGGCAAGAAGATTGCCTTAGAGCAAGTATTATAAGGGCTCATGTGTTGTC[C/T]
CTAAAAATACCACATAAGATTGGTTGAAGAAAGAAAAAGATAACATGTATAACTGGAAAAATATACAGTGCAAACCACAAATATAGTGAAAACATGAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 45.90% 0.38% 0.51% NA
All Indica  2759 82.10% 17.30% 0.51% 0.14% NA
All Japonica  1512 3.20% 95.30% 0.20% 1.26% NA
Aus  269 33.80% 66.20% 0.00% 0.00% NA
Indica I  595 92.60% 6.70% 0.34% 0.34% NA
Indica II  465 94.80% 4.10% 0.86% 0.22% NA
Indica III  913 69.00% 30.80% 0.22% 0.00% NA
Indica Intermediate  786 81.70% 17.40% 0.76% 0.13% NA
Temperate Japonica  767 0.40% 97.00% 0.13% 2.48% NA
Tropical Japonica  504 6.50% 93.30% 0.20% 0.00% NA
Japonica Intermediate  241 5.40% 94.20% 0.41% 0.00% NA
VI/Aromatic  96 76.00% 22.90% 0.00% 1.04% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433184965 G -> DEL N N silent_mutation Average:50.303; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0433184965 G -> A LOC_Os04g55740.1 upstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:50.303; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0433184965 G -> A LOC_Os04g55750.1 upstream_gene_variant ; 848.0bp to feature; MODIFIER silent_mutation Average:50.303; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0433184965 G -> A LOC_Os04g55740-LOC_Os04g55750 intergenic_region ; MODIFIER silent_mutation Average:50.303; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433184965 NA 2.79E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 2.15E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 9.63E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 9.66E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 7.85E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 9.56E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 7.43E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 4.32E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 7.25E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 3.56E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 4.18E-08 mr1488_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 3.21E-11 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 9.40E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 2.32E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 2.89E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 6.96E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 8.79E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 4.70E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 1.70E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 1.13E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 3.51E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 4.04E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 7.60E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 2.35E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965 NA 4.20E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251