Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433184965:

Variant ID: vg0433184965 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33184965
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCATGTTTTCACTATATTTGTGGTTTGCACTGTATATTTTTCCAGTTATACATGTTATCTTTTTCTTTCTTCAACCAATCTTATGTGGTATTTTTAG[G/A]
GACAACACATGAGCCCTTATAATACTTGCTCTAAGGCAATCTTCTTGCCTTGTGTTAAAAAATAAATTTTTTAAAAAATGACGCCAACACCAAGCCCAAA

Reverse complement sequence

TTTGGGCTTGGTGTTGGCGTCATTTTTTAAAAAATTTATTTTTTAACACAAGGCAAGAAGATTGCCTTAGAGCAAGTATTATAAGGGCTCATGTGTTGTC[C/T]
CTAAAAATACCACATAAGATTGGTTGAAGAAAGAAAAAGATAACATGTATAACTGGAAAAATATACAGTGCAAACCACAAATATAGTGAAAACATGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	45.90%	0.38%	0.51%	NA
All Indica	2759	82.10%	17.30%	0.51%	0.14%	NA
All Japonica	1512	3.20%	95.30%	0.20%	1.26%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	92.60%	6.70%	0.34%	0.34%	NA
Indica II	465	94.80%	4.10%	0.86%	0.22%	NA
Indica III	913	69.00%	30.80%	0.22%	0.00%	NA
Indica Intermediate	786	81.70%	17.40%	0.76%	0.13%	NA
Temperate Japonica	767	0.40%	97.00%	0.13%	2.48%	NA
Tropical Japonica	504	6.50%	93.30%	0.20%	0.00%	NA
Japonica Intermediate	241	5.40%	94.20%	0.41%	0.00%	NA
VI/Aromatic	96	76.00%	22.90%	0.00%	1.04%	NA
Intermediate	90	43.30%	55.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433184965	G -> DEL	N	N	silent_mutation	Average:50.303; most accessible tissue: Zhenshan97 root, score: 81.772	N	N	N	N
vg0433184965	G -> A	LOC_Os04g55740.1	upstream_gene_variant ; 3546.0bp to feature; MODIFIER	silent_mutation	Average:50.303; most accessible tissue: Zhenshan97 root, score: 81.772	N	N	N	N
vg0433184965	G -> A	LOC_Os04g55750.1	upstream_gene_variant ; 848.0bp to feature; MODIFIER	silent_mutation	Average:50.303; most accessible tissue: Zhenshan97 root, score: 81.772	N	N	N	N
vg0433184965	G -> A	LOC_Os04g55740-LOC_Os04g55750	intergenic_region ; MODIFIER	silent_mutation	Average:50.303; most accessible tissue: Zhenshan97 root, score: 81.772	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433184965	NA	2.79E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	2.15E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	9.63E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	9.66E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	7.85E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	9.56E-21	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	7.43E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	4.32E-08	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	7.25E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	3.56E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	4.18E-08	mr1488_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	3.21E-11	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	9.40E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	2.32E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	2.89E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	6.96E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	8.79E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	4.70E-21	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	1.70E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	1.13E-08	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	3.51E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	4.04E-22	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	7.60E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	2.35E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433184965	NA	4.20E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251