\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433049261:

Variant ID: vg0433049261 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33049261
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.16, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGAGTTGGTAAAGTAGAGCACGCGTGAAGGATAGGTCTTGGATTTGAATCCTAGCCAAGACACGATATAAAAAAACAAATAGATAAATAGATAGGATG[T/G,A]
TAGATTAATATTTGAACTTTTATTTTGGTACGTAAAACTAATGCCACATATGGAGTGGGTTGCAATATGACTTTTTGCCACATCTATTCCGTGGCAACAT

Reverse complement sequence

ATGTTGCCACGGAATAGATGTGGCAAAAAGTCATATTGCAACCCACTCCATATGTGGCATTAGTTTTACGTACCAAAATAAAAGTTCAAATATTAATCTA[A/C,T]
CATCCTATCTATTTATCTATTTGTTTTTTTATATCGTGTCTTGGCTAGGATTCAAATCCAAGACCTATCCTTCACGCGTGCTCTACTTTACCAACTCACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 33.00% 0.02% 0.00% NA
All Indica  2759 95.80% 4.20% 0.00% 0.00% NA
All Japonica  1512 18.50% 81.50% 0.00% 0.00% NA
Aus  269 37.90% 62.10% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 94.00% 6.00% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 44.00% 56.00% 0.00% 0.00% NA
Japonica Intermediate  241 17.40% 82.60% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433049261 T -> A LOC_Os04g55550.1 upstream_gene_variant ; 3775.0bp to feature; MODIFIER N Average:71.147; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0433049261 T -> A LOC_Os04g55540-LOC_Os04g55550 intergenic_region ; MODIFIER N Average:71.147; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0433049261 T -> G LOC_Os04g55550.1 upstream_gene_variant ; 3775.0bp to feature; MODIFIER silent_mutation Average:71.147; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0433049261 T -> G LOC_Os04g55540-LOC_Os04g55550 intergenic_region ; MODIFIER silent_mutation Average:71.147; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433049261 NA 7.27E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433049261 4.97E-06 4.97E-06 mr1347 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433049261 NA 3.70E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251