\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433044174:

Variant ID: vg0433044174 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33044174
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCCCAGCCTGCCTCTCGCTCACAATGCGGGAAGGCGGCAGCACGCTACCATCGAGCAGAGCGGAGCCCCGTGCCATGGCGCCGGAGGAAGAGAAGATT[A/G]
AGAGCGAGCACGTGTGGCGAAGGTAGGGCACAGGAAAGAAGGAGTTAGGGCGCAAGCGGCGAAGACAAGGGGAATAATGGCGAAAGGAAGGAAACAGATC

Reverse complement sequence

GATCTGTTTCCTTCCTTTCGCCATTATTCCCCTTGTCTTCGCCGCTTGCGCCCTAACTCCTTCTTTCCTGTGCCCTACCTTCGCCACACGTGCTCGCTCT[T/C]
AATCTTCTCTTCCTCCGGCGCCATGGCACGGGGCTCCGCTCTGCTCGATGGTAGCGTGCTGCCGCCTTCCCGCATTGTGAGCGAGAGGCAGGCTGGGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.50% 2.00% 3.13% 63.33% NA
All Indica  2759 3.30% 0.90% 3.99% 91.81% NA
All Japonica  1512 78.60% 0.30% 0.79% 20.37% NA
Aus  269 60.20% 13.80% 5.20% 20.82% NA
Indica I  595 7.10% 0.00% 2.18% 90.76% NA
Indica II  465 2.80% 0.20% 3.23% 93.76% NA
Indica III  913 1.00% 0.90% 6.46% 91.68% NA
Indica Intermediate  786 3.60% 1.90% 2.93% 91.60% NA
Temperate Japonica  767 91.90% 0.00% 0.00% 8.08% NA
Tropical Japonica  504 56.20% 0.20% 2.38% 41.27% NA
Japonica Intermediate  241 83.00% 1.20% 0.00% 15.77% NA
VI/Aromatic  96 12.50% 30.20% 10.42% 46.88% NA
Intermediate  90 38.90% 2.20% 2.22% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433044174 A -> DEL N N silent_mutation Average:7.2; most accessible tissue: Minghui63 root, score: 15.664 N N N N
vg0433044174 A -> G LOC_Os04g55540.1 upstream_gene_variant ; 23.0bp to feature; MODIFIER silent_mutation Average:7.2; most accessible tissue: Minghui63 root, score: 15.664 N N N N
vg0433044174 A -> G LOC_Os04g55530.1 downstream_gene_variant ; 3949.0bp to feature; MODIFIER silent_mutation Average:7.2; most accessible tissue: Minghui63 root, score: 15.664 N N N N
vg0433044174 A -> G LOC_Os04g55540-LOC_Os04g55550 intergenic_region ; MODIFIER silent_mutation Average:7.2; most accessible tissue: Minghui63 root, score: 15.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433044174 NA 2.27E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 3.06E-16 mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 2.82E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 3.11E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 5.71E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 7.59E-06 NA mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 4.55E-06 4.55E-06 mr1146_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 9.44E-06 NA mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 7.20E-06 mr1148_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 4.49E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 2.70E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 3.41E-37 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 3.30E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 8.62E-07 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 3.79E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 2.45E-37 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 7.02E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 4.40E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 1.90E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 9.21E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 5.85E-06 NA mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 4.37E-06 NA mr1611_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 4.91E-06 NA mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 2.25E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 4.11E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 2.02E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 1.55E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 1.37E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 NA 4.13E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433044174 6.16E-06 NA mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251