\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433037993:

Variant ID: vg0433037993 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33037993
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGTCCGACGACGCCAGGAGCCCCCGACCCCCAGGAAGGCCCCGAGGCCACTGTGGGAAGGCCGCACCTGTTATCCTCCGACCCCGAGGTCATCAGCAC[G/A]
GAAGACAAGTGCGCCCCGCGAGGCTGCTTGGACGAAGAGTGCCCCAGGGATGCGGCCCCTAGCGAAGAGGGTCGGACCCACCGAAAGGTGCAGCGGCCCG

Reverse complement sequence

CGGGCCGCTGCACCTTTCGGTGGGTCCGACCCTCTTCGCTAGGGGCCGCATCCCTGGGGCACTCTTCGTCCAAGCAGCCTCGCGGGGCGCACTTGTCTTC[C/T]
GTGCTGATGACCTCGGGGTCGGAGGATAACAGGTGCGGCCTTCCCACAGTGGCCTCGGGGCCTTCCTGGGGGTCGGGGGCTCCTGGCGTCGTCGGACAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.50% 1.20% 17.25% 50.06% NA
All Indica  2759 3.70% 1.10% 23.92% 71.37% NA
All Japonica  1512 77.70% 1.60% 4.56% 16.14% NA
Aus  269 62.10% 0.00% 16.36% 21.56% NA
Indica I  595 6.20% 1.30% 11.26% 81.18% NA
Indica II  465 2.60% 0.40% 15.70% 81.29% NA
Indica III  913 2.10% 1.00% 39.65% 57.28% NA
Indica Intermediate  786 4.20% 1.30% 20.10% 74.43% NA
Temperate Japonica  767 91.10% 0.90% 0.39% 7.56% NA
Tropical Japonica  504 57.10% 0.60% 10.71% 31.55% NA
Japonica Intermediate  241 78.00% 5.80% 4.98% 11.20% NA
VI/Aromatic  96 13.50% 1.00% 28.12% 57.29% NA
Intermediate  90 36.70% 2.20% 16.67% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433037993 G -> DEL LOC_Os04g55530.1 N frameshift_variant Average:20.681; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0433037993 G -> A LOC_Os04g55530.1 synonymous_variant ; p.Thr1141Thr; LOW synonymous_codon Average:20.681; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433037993 NA 4.62E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 1.74E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 1.11E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 4.93E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 2.25E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 7.94E-07 NA mr1115_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 7.52E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 3.21E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 2.12E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 6.20E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 2.42E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 4.28E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 8.54E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 2.76E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 3.32E-06 1.97E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 4.03E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 2.11E-06 NA mr1611_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433037993 NA 2.75E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251