Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433026362:

Variant ID: vg0433026362 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 33026362
Reference Allele: TCC	Alternative Allele: CCC,TC,TCCC,T
Primary Allele: CCC	Secondary Allele: TCC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGCTTCTTCGCATGTCTGCAGCCATCCACCTAATTCTGCGGTGGAAAGATAAACTTTAGTTTCTCACCAATCTGAAAATGTTACGGCAGTTGCTAAAT[TCC/CCC,TC,TCCC,T]
CCCCCCCCCTTACGCACCATCATCTTGTACCTAGTAGTGACACTTAATTTTATTAACTCAACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCACATATC

Reverse complement sequence

GATATGTGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGTTGAGTTAATAAAATTAAGTGTCACTACTAGGTACAAGATGATGGTGCGTAAGGGGGGGGG[GGA/GGG,GA,GGGA,A]
ATTTAGCAACTGCCGTAACATTTTCAGATTGGTGAGAAACTAAAGTTTATCTTTCCACCGCAGAATTAGGTGGATGGCTGCAGACATGCGAAGAAGCATG

Allele Frequencies:

Populations	Population Size	Frequency of CCC(primary allele)	Frequency of TCC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	23.30%	12.72%	2.71%	TC: 5.69%; TCCC: 0.28%; T: 0.02%
All Indica	2759	78.80%	3.20%	13.37%	4.42%	TC: 0.22%; TCCC: 0.04%
All Japonica	1512	14.50%	57.20%	11.11%	0.13%	TC: 16.47%; TCCC: 0.53%; T: 0.07%
Aus	269	35.30%	46.50%	15.99%	0.00%	TC: 1.12%; TCCC: 1.12%
Indica I	595	71.10%	4.40%	21.85%	2.35%	TC: 0.34%
Indica II	465	81.50%	1.30%	13.76%	3.23%	TC: 0.22%
Indica III	913	81.40%	2.80%	9.42%	6.35%	NA
Indica Intermediate	786	80.00%	3.70%	11.32%	4.45%	TC: 0.38%; TCCC: 0.13%
Temperate Japonica	767	0.80%	64.80%	14.86%	0.00%	TC: 19.43%; TCCC: 0.13%
Tropical Japonica	504	39.30%	47.40%	4.17%	0.20%	TC: 7.94%; TCCC: 0.99%
Japonica Intermediate	241	6.20%	53.50%	13.69%	0.41%	TC: 24.90%; TCCC: 0.83%; T: 0.41%
VI/Aromatic	96	76.00%	2.10%	11.46%	3.12%	TC: 7.29%
Intermediate	90	56.70%	25.60%	11.11%	1.11%	TC: 4.44%; TCCC: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433026362	TCC -> TCCC	LOC_Os04g55520.1	downstream_gene_variant ; 4246.0bp to feature; MODIFIER	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0433026362	TCC -> TCCC	LOC_Os04g55510.1	intron_variant ; MODIFIER	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0433026362	TCC -> DEL	N	N	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0433026362	TCC -> CCC	LOC_Os04g55520.1	downstream_gene_variant ; 4249.0bp to feature; MODIFIER	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0433026362	TCC -> CCC	LOC_Os04g55510.1	intron_variant ; MODIFIER	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0433026362	TCC -> TC	LOC_Os04g55520.1	downstream_gene_variant ; 4247.0bp to feature; MODIFIER	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0433026362	TCC -> TC	LOC_Os04g55510.1	intron_variant ; MODIFIER	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0433026362	TCC -> T	LOC_Os04g55520.1	downstream_gene_variant ; 4248.0bp to feature; MODIFIER	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0433026362	TCC -> T	LOC_Os04g55510.1	intron_variant ; MODIFIER	silent_mutation	Average:66.83; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433026362	NA	1.21E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	NA	1.43E-06	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	NA	1.56E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	NA	2.31E-06	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	NA	4.46E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	NA	8.56E-07	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	7.10E-07	3.13E-09	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	NA	8.70E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	NA	2.42E-17	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	NA	1.54E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433026362	3.82E-06	NA	mr1987_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251