Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432977710:

Variant ID: vg0432977710 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32977710
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, C: 0.19, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGGATTACTTTCGCATTCACAAGCTTCCGAATGTAGAGCTTCAGATTTTTTAATACTTACTTTGTCCTATTTTAAGCGCAGCCATGAGTTTCCGTGT[C/T]
TAACTTTAATTGTCGGTCTTATTTAAAAAAAAATCATGATTAATATTTTATTGTTATTAGATGATAAAACATGAATAATACTTACTTATGCTTTTTAATT

Reverse complement sequence

AATTAAAAAGCATAAGTAAGTATTATTCATGTTTTATCATCTAATAACAATAAAATATTAATCATGATTTTTTTTTAAATAAGACCGACAATTAAAGTTA[G/A]
ACACGGAAACTCATGGCTGCGCTTAAAATAGGACAAAGTAAGTATTAAAAAATCTGAAGCTCTACATTCGGAAGCTTGTGAATGCGAAAGTAATCCAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	31.00%	0.25%	0.00%	NA
All Indica	2759	95.80%	3.90%	0.29%	0.00%	NA
All Japonica	1512	22.60%	77.30%	0.07%	0.00%	NA
Aus	269	53.20%	46.50%	0.37%	0.00%	NA
Indica I	595	93.90%	5.70%	0.34%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	94.70%	5.10%	0.11%	0.00%	NA
Indica Intermediate	786	97.10%	2.40%	0.51%	0.00%	NA
Temperate Japonica	767	14.30%	85.70%	0.00%	0.00%	NA
Tropical Japonica	504	37.70%	62.30%	0.00%	0.00%	NA
Japonica Intermediate	241	17.40%	82.20%	0.41%	0.00%	NA
VI/Aromatic	96	67.70%	31.20%	1.04%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432977710	C -> T	LOC_Os04g55450.1	upstream_gene_variant ; 2186.0bp to feature; MODIFIER	silent_mutation	Average:46.048; most accessible tissue: Callus, score: 90.618	N	N	N	N
vg0432977710	C -> T	LOC_Os04g55440.1	downstream_gene_variant ; 18.0bp to feature; MODIFIER	silent_mutation	Average:46.048; most accessible tissue: Callus, score: 90.618	N	N	N	N
vg0432977710	C -> T	LOC_Os04g55440-LOC_Os04g55450	intergenic_region ; MODIFIER	silent_mutation	Average:46.048; most accessible tissue: Callus, score: 90.618	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432977710	NA	1.36E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	5.54E-08	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	4.59E-06	8.20E-10	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	1.19E-07	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	2.23E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	1.21E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	7.47E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	6.49E-07	6.02E-10	mr1295_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	1.78E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	6.17E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	4.45E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	9.06E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432977710	NA	1.65E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251