Variant ID: vg0432917170 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 32917170 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 200. )
CTTTTCTCATTCCCATTGGCTTGGGTTCTTTATCTTGTACTTGATTTCTTGGCTGCTGTGCTGGAACATCCAAAGGTACAATGCCGATACTGGCCTCTGT[G/C]
TTGTCAACTGGTGGCTGGGGCTGAAGTTGAGCATTGACACCTTGTGGTAATGCACTCGCTGGAGTTGGAGCTGTTGCAACGGGGGCTATAGGACTGCTTC
GAAGCAGTCCTATAGCCCCCGTTGCAACAGCTCCAACTCCAGCGAGTGCATTACCACAAGGTGTCAATGCTCAACTTCAGCCCCAGCCACCAGTTGACAA[C/G]
ACAGAGGCCAGTATCGGCATTGTACCTTTGGATGTTCCAGCACAGCAGCCAAGAAATCAAGTACAAGATAAAGAACCCAAGCCAATGGGAATGAGAAAAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 27.30% | 26.20% | 9.80% | 36.67% | NA |
All Indica | 2759 | 3.30% | 36.00% | 10.33% | 50.34% | NA |
All Japonica | 1512 | 69.00% | 5.30% | 6.75% | 18.98% | NA |
Aus | 269 | 41.30% | 29.00% | 18.59% | 11.15% | NA |
Indica I | 595 | 4.20% | 6.20% | 7.23% | 82.35% | NA |
Indica II | 465 | 2.80% | 43.90% | 4.09% | 49.25% | NA |
Indica III | 913 | 2.40% | 51.30% | 13.69% | 32.64% | NA |
Indica Intermediate | 786 | 3.90% | 36.30% | 12.47% | 47.33% | NA |
Temperate Japonica | 767 | 90.00% | 0.00% | 1.17% | 8.87% | NA |
Tropical Japonica | 504 | 41.70% | 13.30% | 14.48% | 30.56% | NA |
Japonica Intermediate | 241 | 59.30% | 5.40% | 8.30% | 26.97% | NA |
VI/Aromatic | 96 | 16.70% | 64.60% | 13.54% | 5.21% | NA |
Intermediate | 90 | 34.40% | 26.70% | 14.44% | 24.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0432917170 | G -> C | LOC_Os04g55340.1 | missense_variant ; p.Asn499Lys; MODERATE | nonsynonymous_codon | Average:7.343; most accessible tissue: Callus, score: 19.95 | possibly damaging | -1.599 | TOLERATED | 1.00 |
vg0432917170 | G -> DEL | LOC_Os04g55340.1 | N | frameshift_variant | Average:7.343; most accessible tissue: Callus, score: 19.95 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0432917170 | NA | 3.40E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432917170 | 9.93E-06 | 1.00E-07 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432917170 | NA | 1.32E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432917170 | NA | 9.67E-07 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432917170 | NA | 3.58E-08 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432917170 | 1.87E-07 | 4.37E-13 | mr1789_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |