Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432876148:

Variant ID: vg0432876148 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32876148
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAAGGTTCCCGGGTGCCTATGTGATTATTAAGGCAGGGTGCTACTGTACCAGTAGTAGAGTGGCTTGAATCAAATCGTTTGTCTAGAGAGGGTGTAGC[G/A]
ATAACCAAAGTTGACTGTACTAGAAACTTTAGATCCTGTATAGGCAACTGGCCTTAGAATAGTGTCTTGAACTACAGGAACGACCCATAATCATTGACGA

Reverse complement sequence

TCGTCAATGATTATGGGTCGTTCCTGTAGTTCAAGACACTATTCTAAGGCCAGTTGCCTATACAGGATCTAAAGTTTCTAGTACAGTCAACTTTGGTTAT[C/T]
GCTACACCCTCTCTAGACAAACGATTTGATTCAAGCCACTCTACTACTGGTACAGTAGCACCCTGCCTTAATAATCACATAGGCACCCGGGAACCTTACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.00%	0.90%	10.92%	60.18%	NA
All Indica	2759	2.90%	1.30%	6.67%	89.16%	NA
All Japonica	1512	70.60%	0.30%	19.51%	9.59%	NA
Aus	269	43.90%	1.50%	3.72%	50.93%	NA
Indica I	595	4.00%	0.70%	6.22%	89.08%	NA
Indica II	465	2.60%	0.60%	3.44%	93.33%	NA
Indica III	913	1.80%	2.50%	10.62%	85.10%	NA
Indica Intermediate	786	3.40%	0.80%	4.33%	91.48%	NA
Temperate Japonica	767	91.30%	0.10%	7.95%	0.65%	NA
Tropical Japonica	504	43.80%	0.60%	29.96%	25.60%	NA
Japonica Intermediate	241	61.00%	0.00%	34.44%	4.56%	NA
VI/Aromatic	96	24.00%	0.00%	15.62%	60.42%	NA
Intermediate	90	37.80%	0.00%	13.33%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432876148	G -> DEL	N	N	silent_mutation	Average:12.101; most accessible tissue: Callus, score: 34.203	N	N	N	N
vg0432876148	G -> A	LOC_Os04g55290.1	upstream_gene_variant ; 4527.0bp to feature; MODIFIER	silent_mutation	Average:12.101; most accessible tissue: Callus, score: 34.203	N	N	N	N
vg0432876148	G -> A	LOC_Os04g55290.2	upstream_gene_variant ; 4527.0bp to feature; MODIFIER	silent_mutation	Average:12.101; most accessible tissue: Callus, score: 34.203	N	N	N	N
vg0432876148	G -> A	LOC_Os04g55290.4	upstream_gene_variant ; 4527.0bp to feature; MODIFIER	silent_mutation	Average:12.101; most accessible tissue: Callus, score: 34.203	N	N	N	N
vg0432876148	G -> A	LOC_Os04g55290.5	upstream_gene_variant ; 4527.0bp to feature; MODIFIER	silent_mutation	Average:12.101; most accessible tissue: Callus, score: 34.203	N	N	N	N
vg0432876148	G -> A	LOC_Os04g55300.1	downstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:12.101; most accessible tissue: Callus, score: 34.203	N	N	N	N
vg0432876148	G -> A	LOC_Os04g55300-LOC_Os04g55310	intergenic_region ; MODIFIER	silent_mutation	Average:12.101; most accessible tissue: Callus, score: 34.203	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432876148	NA	6.87E-06	mr1049_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.24E-07	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	8.87E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	2.08E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	2.86E-08	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	5.84E-06	NA	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.37E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	4.88E-06	4.87E-06	mr1146_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	4.77E-06	mr1152_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	4.05E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	7.48E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	2.19E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	5.39E-06	5.39E-06	mr1244_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	5.92E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	6.67E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.71E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.05E-06	mr1253_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	4.00E-06	mr1255_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.61E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	3.22E-08	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.30E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	8.60E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.66E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	2.92E-06	NA	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	6.32E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	3.66E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	2.77E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.89E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	4.84E-06	3.85E-11	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	2.92E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	3.49E-06	NA	mr1849_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	1.72E-06	mr1887_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432876148	NA	7.81E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251