Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432863071:

Variant ID: vg0432863071 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32863071
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTAGACACCTCCGATTTGTATATAATCACTAAAAAAAATTTCACAAGAAATTTTGGCATAACCTCCTTTCTTTCTTTAAGAAATTTTGAAGTTTGCTC[A/G]
GGCTCTTTAAGAAATTTTGAAGCTTGCTCAGGCTGGAGGAGGAAGAAGACATATATAAATGGGGGATTTTTAAGTCCCGGTTGGTAAGATCCCGGAGGGC

Reverse complement sequence

GCCCTCCGGGATCTTACCAACCGGGACTTAAAAATCCCCCATTTATATATGTCTTCTTCCTCCTCCAGCCTGAGCAAGCTTCAAAATTTCTTAAAGAGCC[T/C]
GAGCAAACTTCAAAATTTCTTAAAGAAAGAAAGGAGGTTATGCCAAAATTTCTTGTGAAATTTTTTTTAGTGATTATATACAAATCGGAGGTGTCTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	0.30%	4.95%	14.62%	NA
All Indica	2759	70.40%	0.30%	7.07%	22.22%	NA
All Japonica	1512	97.10%	0.10%	0.79%	2.05%	NA
Aus	269	84.40%	0.00%	5.20%	10.41%	NA
Indica I	595	75.50%	0.30%	6.39%	17.82%	NA
Indica II	465	65.20%	0.20%	7.31%	27.31%	NA
Indica III	913	70.80%	0.30%	8.21%	20.70%	NA
Indica Intermediate	786	69.20%	0.40%	6.11%	24.30%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	92.50%	0.20%	2.38%	4.96%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	82.30%	1.00%	6.25%	10.42%	NA
Intermediate	90	81.10%	1.10%	7.78%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432863071	A -> DEL	N	N	silent_mutation	Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0432863071	A -> G	LOC_Os04g55260.1	upstream_gene_variant ; 2428.0bp to feature; MODIFIER	silent_mutation	Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0432863071	A -> G	LOC_Os04g55270.1	upstream_gene_variant ; 601.0bp to feature; MODIFIER	silent_mutation	Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0432863071	A -> G	LOC_Os04g55280.1	downstream_gene_variant ; 1879.0bp to feature; MODIFIER	silent_mutation	Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0432863071	A -> G	LOC_Os04g55260-LOC_Os04g55270	intergenic_region ; MODIFIER	silent_mutation	Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432863071	NA	8.74E-10	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	1.27E-12	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	2.41E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	9.45E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	1.41E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	9.76E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	4.77E-06	NA	mr1825	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	1.70E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	3.53E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	3.85E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	9.06E-08	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	5.88E-08	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	5.48E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071	NA	1.57E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251