\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432863071:

Variant ID: vg0432863071 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32863071
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTAGACACCTCCGATTTGTATATAATCACTAAAAAAAATTTCACAAGAAATTTTGGCATAACCTCCTTTCTTTCTTTAAGAAATTTTGAAGTTTGCTC[A/G]
GGCTCTTTAAGAAATTTTGAAGCTTGCTCAGGCTGGAGGAGGAAGAAGACATATATAAATGGGGGATTTTTAAGTCCCGGTTGGTAAGATCCCGGAGGGC

Reverse complement sequence

GCCCTCCGGGATCTTACCAACCGGGACTTAAAAATCCCCCATTTATATATGTCTTCTTCCTCCTCCAGCCTGAGCAAGCTTCAAAATTTCTTAAAGAGCC[T/C]
GAGCAAACTTCAAAATTTCTTAAAGAAAGAAAGGAGGTTATGCCAAAATTTCTTGTGAAATTTTTTTTAGTGATTATATACAAATCGGAGGTGTCTAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 0.30% 4.95% 14.62% NA
All Indica  2759 70.40% 0.30% 7.07% 22.22% NA
All Japonica  1512 97.10% 0.10% 0.79% 2.05% NA
Aus  269 84.40% 0.00% 5.20% 10.41% NA
Indica I  595 75.50% 0.30% 6.39% 17.82% NA
Indica II  465 65.20% 0.20% 7.31% 27.31% NA
Indica III  913 70.80% 0.30% 8.21% 20.70% NA
Indica Intermediate  786 69.20% 0.40% 6.11% 24.30% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 92.50% 0.20% 2.38% 4.96% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 82.30% 1.00% 6.25% 10.42% NA
Intermediate  90 81.10% 1.10% 7.78% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432863071 A -> DEL N N silent_mutation Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0432863071 A -> G LOC_Os04g55260.1 upstream_gene_variant ; 2428.0bp to feature; MODIFIER silent_mutation Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0432863071 A -> G LOC_Os04g55270.1 upstream_gene_variant ; 601.0bp to feature; MODIFIER silent_mutation Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0432863071 A -> G LOC_Os04g55280.1 downstream_gene_variant ; 1879.0bp to feature; MODIFIER silent_mutation Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0432863071 A -> G LOC_Os04g55260-LOC_Os04g55270 intergenic_region ; MODIFIER silent_mutation Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432863071 NA 8.74E-10 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 1.27E-12 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 2.41E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 9.45E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 1.41E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 9.76E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 4.77E-06 NA mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 1.70E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 3.53E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 3.85E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 9.06E-08 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 5.88E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 5.48E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432863071 NA 1.57E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251