\
| Variant ID: vg0432863071 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32863071 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.02, others allele: 0.00, population size: 55. )
TTTTAGACACCTCCGATTTGTATATAATCACTAAAAAAAATTTCACAAGAAATTTTGGCATAACCTCCTTTCTTTCTTTAAGAAATTTTGAAGTTTGCTC[A/G]
GGCTCTTTAAGAAATTTTGAAGCTTGCTCAGGCTGGAGGAGGAAGAAGACATATATAAATGGGGGATTTTTAAGTCCCGGTTGGTAAGATCCCGGAGGGC
GCCCTCCGGGATCTTACCAACCGGGACTTAAAAATCCCCCATTTATATATGTCTTCTTCCTCCTCCAGCCTGAGCAAGCTTCAAAATTTCTTAAAGAGCC[T/C]
GAGCAAACTTCAAAATTTCTTAAAGAAAGAAAGGAGGTTATGCCAAAATTTCTTGTGAAATTTTTTTTAGTGATTATATACAAATCGGAGGTGTCTAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.20% | 0.30% | 4.95% | 14.62% | NA |
| All Indica | 2759 | 70.40% | 0.30% | 7.07% | 22.22% | NA |
| All Japonica | 1512 | 97.10% | 0.10% | 0.79% | 2.05% | NA |
| Aus | 269 | 84.40% | 0.00% | 5.20% | 10.41% | NA |
| Indica I | 595 | 75.50% | 0.30% | 6.39% | 17.82% | NA |
| Indica II | 465 | 65.20% | 0.20% | 7.31% | 27.31% | NA |
| Indica III | 913 | 70.80% | 0.30% | 8.21% | 20.70% | NA |
| Indica Intermediate | 786 | 69.20% | 0.40% | 6.11% | 24.30% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 92.50% | 0.20% | 2.38% | 4.96% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 82.30% | 1.00% | 6.25% | 10.42% | NA |
| Intermediate | 90 | 81.10% | 1.10% | 7.78% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432863071 | A -> DEL | N | N | silent_mutation | Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0432863071 | A -> G | LOC_Os04g55260.1 | upstream_gene_variant ; 2428.0bp to feature; MODIFIER | silent_mutation | Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0432863071 | A -> G | LOC_Os04g55270.1 | upstream_gene_variant ; 601.0bp to feature; MODIFIER | silent_mutation | Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0432863071 | A -> G | LOC_Os04g55280.1 | downstream_gene_variant ; 1879.0bp to feature; MODIFIER | silent_mutation | Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0432863071 | A -> G | LOC_Os04g55260-LOC_Os04g55270 | intergenic_region ; MODIFIER | silent_mutation | Average:45.087; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432863071 | NA | 8.74E-10 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 1.27E-12 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 2.41E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 9.45E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 1.41E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 9.76E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | 4.77E-06 | NA | mr1825 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 1.70E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 3.53E-07 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 3.85E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 9.06E-08 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 5.88E-08 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 5.48E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432863071 | NA | 1.57E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |