Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432860646:

Variant ID: vg0432860646 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32860646
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, G: 0.14, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTGTCGACTTGTGGATGCGGGACGCGGCCGCGCGGGGAGCCCGGCGTGCGTCGCCTTCGGTGTTGTGCTGCGGCGGAAGCGAGATTGATGGGGCCTTG[T/G]
GTACCTGTGCTGGACTGGCCCATGAATATTTTTTTTCCTTGTAAAAAACAATTAGATATAAGAGCAGGTACAATAGCAGGCTATTAGTCAGCTATAAACA

Reverse complement sequence

TGTTTATAGCTGACTAATAGCCTGCTATTGTACCTGCTCTTATATCTAATTGTTTTTTACAAGGAAAAAAAATATTCATGGGCCAGTCCAGCACAGGTAC[A/C]
CAAGGCCCCATCAATCTCGCTTCCGCCGCAGCACAACACCGAAGGCGACGCACGCCGGGCTCCCCGCGCGGCCGCGTCCCGCATCCACAAGTCGACAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.30% 0.06% 0.00% NA
All Indica  2759 97.30% 2.70% 0.04% 0.00% NA
All Japonica  1512 9.90% 90.10% 0.00% 0.00% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 93.90% 6.10% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.40% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 26.20% 73.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 35.40% 1.04% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432860646 T -> G LOC_Os04g55260.1 upstream_gene_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:98.173; most accessible tissue: Zhenshan97 panicle, score: 99.339 N N N N
vg0432860646 T -> G LOC_Os04g55270.1 upstream_gene_variant ; 3026.0bp to feature; MODIFIER silent_mutation Average:98.173; most accessible tissue: Zhenshan97 panicle, score: 99.339 N N N N
vg0432860646 T -> G LOC_Os04g55250.1 downstream_gene_variant ; 3534.0bp to feature; MODIFIER silent_mutation Average:98.173; most accessible tissue: Zhenshan97 panicle, score: 99.339 N N N N
vg0432860646 T -> G LOC_Os04g55280.1 downstream_gene_variant ; 4304.0bp to feature; MODIFIER silent_mutation Average:98.173; most accessible tissue: Zhenshan97 panicle, score: 99.339 N N N N
vg0432860646 T -> G LOC_Os04g55260-LOC_Os04g55270 intergenic_region ; MODIFIER silent_mutation Average:98.173; most accessible tissue: Zhenshan97 panicle, score: 99.339 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432860646 T G 0.04 0.0 -0.03 0.06 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432860646 NA 1.01E-09 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 1.78E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 1.80E-07 6.87E-06 mr1040_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 9.49E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 4.95E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 1.78E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 9.50E-06 mr1148_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 1.87E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 4.76E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 7.91E-06 mr1236_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 2.44E-06 6.07E-08 mr1252_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 8.78E-07 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 5.99E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 5.78E-06 2.41E-08 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 3.07E-06 2.29E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 5.90E-07 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 8.36E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 NA 9.69E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 4.61E-07 8.62E-08 mr1741_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 4.34E-06 NA mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 3.68E-06 7.93E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 4.21E-06 NA mr1873_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 3.96E-07 NA mr1874_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432860646 9.02E-06 1.54E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251