Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432816657:

Variant ID: vg0432816657 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32816657
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTCAGCCGATTGCCTTTATATCATTATCTACATTGGACATATAGCCGATTGCTTAAACCCTATCGGCATCGGCTGCTATCAGCATCGGCTATTATCGG[C/T]
ATCGGCTGGAACTACTCCATCGGCTTGTCAGCCGATCGGTTGTTTTGATCTACTATTTGCATATCTTGTCAGTTACAGGATCAAACTGACTGGCACGCTC

Reverse complement sequence

GAGCGTGCCAGTCAGTTTGATCCTGTAACTGACAAGATATGCAAATAGTAGATCAAAACAACCGATCGGCTGACAAGCCGATGGAGTAGTTCCAGCCGAT[G/A]
CCGATAATAGCCGATGCTGATAGCAGCCGATGCCGATAGGGTTTAAGCAATCGGCTATATGTCCAATGTAGATAATGATATAAAGGCAATCGGCTGACGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.00%	27.80%	26.75%	14.41%	NA
All Indica	2759	5.60%	32.60%	39.29%	22.51%	NA
All Japonica	1512	74.80%	19.80%	3.97%	1.39%	NA
Aus	269	42.80%	23.00%	25.28%	8.92%	NA
Indica I	595	6.90%	29.40%	39.66%	24.03%	NA
Indica II	465	2.20%	32.30%	40.86%	24.73%	NA
Indica III	913	6.50%	34.20%	39.21%	20.15%	NA
Indica Intermediate	786	5.60%	33.50%	38.17%	22.77%	NA
Temperate Japonica	767	86.70%	13.00%	0.13%	0.13%	NA
Tropical Japonica	504	68.50%	16.90%	10.91%	3.77%	NA
Japonica Intermediate	241	50.20%	47.70%	1.66%	0.41%	NA
VI/Aromatic	96	31.20%	28.10%	35.42%	5.21%	NA
Intermediate	90	41.10%	27.80%	20.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432816657	C -> DEL	N	N	silent_mutation	Average:36.743; most accessible tissue: Zhenshan97 flower, score: 74.205	N	N	N	N
vg0432816657	C -> T	LOC_Os04g55190.1	upstream_gene_variant ; 3502.0bp to feature; MODIFIER	silent_mutation	Average:36.743; most accessible tissue: Zhenshan97 flower, score: 74.205	N	N	N	N
vg0432816657	C -> T	LOC_Os04g55200.1	upstream_gene_variant ; 1513.0bp to feature; MODIFIER	silent_mutation	Average:36.743; most accessible tissue: Zhenshan97 flower, score: 74.205	N	N	N	N
vg0432816657	C -> T	LOC_Os04g55210.1	upstream_gene_variant ; 3989.0bp to feature; MODIFIER	silent_mutation	Average:36.743; most accessible tissue: Zhenshan97 flower, score: 74.205	N	N	N	N
vg0432816657	C -> T	LOC_Os04g55190-LOC_Os04g55200	intergenic_region ; MODIFIER	silent_mutation	Average:36.743; most accessible tissue: Zhenshan97 flower, score: 74.205	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432816657	3.79E-06	3.79E-06	mr1524	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432816657	NA	4.17E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251