| Variant ID: vg0432785736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32785736 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTATATATAGGGGATAAAAGAAAGACACCTAATAGGACTTCTACTAGGAAACTAATCCGATAATATTGTGGGCCCAAAATTCGGATCACATATTTAACA[C/T]
AAAGGGTGTAATTTATCTATTTGGAGCAAAGGAAGAAGAACAAATCTTCGTATATAAGAGCTAAAAGTGTGGAATTGTATAACTTATTATCGACTATGAG
CTCATAGTCGATAATAAGTTATACAATTCCACACTTTTAGCTCTTATATACGAAGATTTGTTCTTCTTCCTTTGCTCCAAATAGATAAATTACACCCTTT[G/A]
TGTTAAATATGTGATCCGAATTTTGGGCCCACAATATTATCGGATTAGTTTCCTAGTAGAAGTCCTATTAGGTGTCTTTCTTTTATCCCCTATATATACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432785736 | C -> T | LOC_Os04g55140.1 | upstream_gene_variant ; 740.0bp to feature; MODIFIER | silent_mutation | Average:49.679; most accessible tissue: Callus, score: 77.087 | N | N | N | N |
| vg0432785736 | C -> T | LOC_Os04g55150.2 | upstream_gene_variant ; 2980.0bp to feature; MODIFIER | silent_mutation | Average:49.679; most accessible tissue: Callus, score: 77.087 | N | N | N | N |
| vg0432785736 | C -> T | LOC_Os04g55140-LOC_Os04g55150 | intergenic_region ; MODIFIER | silent_mutation | Average:49.679; most accessible tissue: Callus, score: 77.087 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432785736 | NA | 3.84E-07 | mr1206 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432785736 | 4.50E-07 | 4.50E-07 | mr1663 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432785736 | NA | 9.29E-09 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |