\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432779782:

Variant ID: vg0432779782 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32779782
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAGTCGTAGTCTCATCGGTTGCCATATTTCTTAATAAGCTTTTTTTTATTGGGAAAATTGGAACCATGTCATTATAATTTTGTAAAATTTGAGATATG[C/T,A]
CATCCTGATCCACATGTCATTTACATGTCATTGAGATACCGATGGCATATCTCAAACTTTACAAAATTATAATGGCATGGTTCCAATTTATCCTTTTTTA

Reverse complement sequence

TAAAAAAGGATAAATTGGAACCATGCCATTATAATTTTGTAAAGTTTGAGATATGCCATCGGTATCTCAATGACATGTAAATGACATGTGGATCAGGATG[G/A,T]
CATATCTCAAATTTTACAAAATTATAATGACATGGTTCCAATTTTCCCAATAAAAAAAAGCTTATTAAGAAATATGGCAACCGATGAGACTACGACTTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 27.70% 0.57% 0.72% A: 0.59%
All Indica  2759 95.30% 1.90% 0.62% 1.16% A: 1.01%
All Japonica  1512 25.30% 74.30% 0.26% 0.13% NA
Aus  269 64.70% 34.20% 1.12% 0.00% NA
Indica I  595 94.10% 3.40% 1.68% 0.84% NA
Indica II  465 97.00% 1.30% 0.22% 1.51% NA
Indica III  913 96.80% 0.10% 0.44% 0.88% A: 1.75%
Indica Intermediate  786 93.50% 3.20% 0.25% 1.53% A: 1.53%
Temperate Japonica  767 3.90% 96.00% 0.13% 0.00% NA
Tropical Japonica  504 61.90% 37.50% 0.20% 0.40% NA
Japonica Intermediate  241 16.60% 82.60% 0.83% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 62.20% 34.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432779782 C -> DEL N N silent_mutation Average:96.474; most accessible tissue: Callus, score: 99.684 N N N N
vg0432779782 C -> A LOC_Os04g55130.1 upstream_gene_variant ; 651.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Callus, score: 99.684 N N N N
vg0432779782 C -> A LOC_Os04g55140.1 downstream_gene_variant ; 1317.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Callus, score: 99.684 N N N N
vg0432779782 C -> A LOC_Os04g55130-LOC_Os04g55140 intergenic_region ; MODIFIER silent_mutation Average:96.474; most accessible tissue: Callus, score: 99.684 N N N N
vg0432779782 C -> T LOC_Os04g55130.1 upstream_gene_variant ; 651.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Callus, score: 99.684 N N N N
vg0432779782 C -> T LOC_Os04g55140.1 downstream_gene_variant ; 1317.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Callus, score: 99.684 N N N N
vg0432779782 C -> T LOC_Os04g55130-LOC_Os04g55140 intergenic_region ; MODIFIER silent_mutation Average:96.474; most accessible tissue: Callus, score: 99.684 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432779782 C A -0.01 -0.01 -0.01 0.0 -0.01 0.0
vg0432779782 C T 0.0 -0.01 -0.01 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432779782 2.65E-07 2.04E-12 mr1040 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 2.65E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 4.70E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 1.56E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 1.41E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 3.31E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 6.68E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 3.59E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 3.88E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 5.01E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 1.47E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 1.82E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 8.72E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 3.08E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 3.64E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 3.32E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432779782 NA 8.07E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251