Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432750231:

Variant ID: vg0432750231 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32750231
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTGAATCACCATTCTACATACTATTTAAATTTAAATTATCATAAACCACATTAATTTACTTAATCTGGTGTTATCTAACTATCTTACATGTTTTTTTTTG[T/C]
TATCATACTAAATTTCCACAGCAATGCGCGGGATTTTACCTAGTATGTAATATATCAACGCACAAACTGTATCTTGTTAATTTCTTTTTTAAAAAATATA

Reverse complement sequence

TATATTTTTTAAAAAAGAAATTAACAAGATACAGTTTGTGCGTTGATATATTACATACTAGGTAAAATCCCGCGCATTGCTGTGGAAATTTAGTATGATA[A/G]
CAAAAAAAAACATGTAAGATAGTTAGATAACACCAGATTAAGTAAATTAATGTGGTTTATGATAATTTAAATTTAAATAGTATGTAGAATGGTGATTCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.30%	6.20%	1.78%	62.72%	NA
All Indica	2759	4.50%	0.20%	2.79%	92.53%	NA
All Japonica	1512	72.80%	18.50%	0.07%	8.66%	NA
Aus	269	36.80%	0.00%	0.74%	62.45%	NA
Indica I	595	6.70%	0.50%	0.34%	92.44%	NA
Indica II	465	2.80%	0.20%	0.43%	96.56%	NA
Indica III	913	3.50%	0.00%	5.15%	91.35%	NA
Indica Intermediate	786	5.00%	0.10%	3.31%	91.60%	NA
Temperate Japonica	767	85.70%	13.40%	0.00%	0.91%	NA
Tropical Japonica	504	69.60%	7.70%	0.20%	22.42%	NA
Japonica Intermediate	241	38.20%	57.30%	0.00%	4.56%	NA
VI/Aromatic	96	32.30%	0.00%	1.04%	66.67%	NA
Intermediate	90	36.70%	6.70%	3.33%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432750231	T -> C	LOC_Os04g55080.1	upstream_gene_variant ; 3434.0bp to feature; MODIFIER	silent_mutation	Average:52.763; most accessible tissue: Callus, score: 76.207	N	N	N	N
vg0432750231	T -> C	LOC_Os04g55060.1	downstream_gene_variant ; 3726.0bp to feature; MODIFIER	silent_mutation	Average:52.763; most accessible tissue: Callus, score: 76.207	N	N	N	N
vg0432750231	T -> C	LOC_Os04g55070.1	intron_variant ; MODIFIER	silent_mutation	Average:52.763; most accessible tissue: Callus, score: 76.207	N	N	N	N
vg0432750231	T -> DEL	N	N	silent_mutation	Average:52.763; most accessible tissue: Callus, score: 76.207	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432750231	NA	6.39E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	1.74E-07	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	3.19E-07	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	4.88E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	2.29E-09	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	1.34E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	1.27E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	1.19E-07	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	2.20E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	1.21E-06	NA	mr1247	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	2.83E-08	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	4.54E-08	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	1.53E-08	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	4.05E-11	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	5.81E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	2.84E-06	NA	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	3.39E-06	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	3.12E-07	NA	mr1917	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	9.15E-07	3.57E-09	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	4.03E-06	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	4.48E-07	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	1.38E-08	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	1.39E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	2.16E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	4.48E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	2.10E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	5.76E-07	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	6.19E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432750231	NA	7.01E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251