\
| Variant ID: vg0432749163 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32749163 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATATGTTAATAATGAATCTAGACATATATGTGTGCCTAGATTCATTAACATCTATATGAATATGGACAATGCTAGAAAGTCTTATAACATGAAACGGAG[G/A,T]
GAGTAGTTATAAAAAAATATTTTAATATATATCCCTATCCCTACTATTATAAAAATTAAAGATATTTTTACCGGCACTTTTGGTACGTTATCTGTGTATG
CATACACAGATAACGTACCAAAAGTGCCGGTAAAAATATCTTTAATTTTTATAATAGTAGGGATAGGGATATATATTAAAATATTTTTTTATAACTACTC[C/T,A]
CTCCGTTTCATGTTATAAGACTTTCTAGCATTGTCCATATTCATATAGATGTTAATGAATCTAGGCACACATATATGTCTAGATTCATTATTAACATATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.80% | 0.66% | 0.00% | T: 0.04% |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | T: 0.07% |
| All Japonica | 1512 | 92.50% | 5.50% | 1.98% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.17% | 0.00% | T: 0.34% |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.60% | 6.00% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 13.30% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432749163 | G -> A | LOC_Os04g55080.1 | upstream_gene_variant ; 4502.0bp to feature; MODIFIER | silent_mutation | Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 | N | N | N | N |
| vg0432749163 | G -> A | LOC_Os04g55060.1 | downstream_gene_variant ; 2658.0bp to feature; MODIFIER | silent_mutation | Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 | N | N | N | N |
| vg0432749163 | G -> A | LOC_Os04g55070.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 | N | N | N | N |
| vg0432749163 | G -> T | LOC_Os04g55080.1 | upstream_gene_variant ; 4502.0bp to feature; MODIFIER | silent_mutation | Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 | N | N | N | N |
| vg0432749163 | G -> T | LOC_Os04g55060.1 | downstream_gene_variant ; 2658.0bp to feature; MODIFIER | silent_mutation | Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 | N | N | N | N |
| vg0432749163 | G -> T | LOC_Os04g55070.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432749163 | 9.62E-06 | NA | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 3.67E-06 | 4.84E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 4.01E-06 | 1.11E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 2.05E-06 | 4.50E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 2.74E-06 | 1.57E-06 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 4.87E-07 | 2.87E-07 | mr1240 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 1.34E-07 | 5.89E-08 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 2.72E-06 | 2.64E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 2.98E-06 | 6.97E-06 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 2.98E-06 | 6.97E-06 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 5.37E-06 | 5.37E-06 | mr1868 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 3.81E-08 | 9.59E-09 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432749163 | 1.68E-06 | 7.55E-07 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |