\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432749163:

Variant ID: vg0432749163 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32749163
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATGTTAATAATGAATCTAGACATATATGTGTGCCTAGATTCATTAACATCTATATGAATATGGACAATGCTAGAAAGTCTTATAACATGAAACGGAG[G/A,T]
GAGTAGTTATAAAAAAATATTTTAATATATATCCCTATCCCTACTATTATAAAAATTAAAGATATTTTTACCGGCACTTTTGGTACGTTATCTGTGTATG

Reverse complement sequence

CATACACAGATAACGTACCAAAAGTGCCGGTAAAAATATCTTTAATTTTTATAATAGTAGGGATAGGGATATATATTAAAATATTTTTTTATAACTACTC[C/T,A]
CTCCGTTTCATGTTATAAGACTTTCTAGCATTGTCCATATTCATATAGATGTTAATGAATCTAGGCACACATATATGTCTAGATTCATTATTAACATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 1.80% 0.66% 0.00% T: 0.04%
All Indica  2759 99.90% 0.00% 0.04% 0.00% T: 0.07%
All Japonica  1512 92.50% 5.50% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.17% 0.00% T: 0.34%
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 90.60% 6.00% 3.39% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 13.30% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432749163 G -> A LOC_Os04g55080.1 upstream_gene_variant ; 4502.0bp to feature; MODIFIER silent_mutation Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0432749163 G -> A LOC_Os04g55060.1 downstream_gene_variant ; 2658.0bp to feature; MODIFIER silent_mutation Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0432749163 G -> A LOC_Os04g55070.1 intron_variant ; MODIFIER silent_mutation Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0432749163 G -> T LOC_Os04g55080.1 upstream_gene_variant ; 4502.0bp to feature; MODIFIER silent_mutation Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0432749163 G -> T LOC_Os04g55060.1 downstream_gene_variant ; 2658.0bp to feature; MODIFIER silent_mutation Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0432749163 G -> T LOC_Os04g55070.1 intron_variant ; MODIFIER silent_mutation Average:40.084; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432749163 9.62E-06 NA mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 3.67E-06 4.84E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 4.01E-06 1.11E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 2.05E-06 4.50E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 2.74E-06 1.57E-06 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 4.87E-07 2.87E-07 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 1.34E-07 5.89E-08 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 2.72E-06 2.64E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 2.98E-06 6.97E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 2.98E-06 6.97E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 5.37E-06 5.37E-06 mr1868 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 3.81E-08 9.59E-09 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432749163 1.68E-06 7.55E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251