Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432747868:

Variant ID: vg0432747868 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32747868
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATACCAACCAGGACTACAAATCAGTTTCCCACGTTATTTCAACCGAGACTAAAAATAGACATTTTTAGTCCCGGATTCGTAGTCCCGGTTAGAAAACC[A/G]
GAACTATAGGGGGTTCCCAACCTTGGGACTAAAAAGCGATTCTCCAGCAGTGAACTAACAGTGCATAAATAAAAGAGTGACTAGCAATGTGAGCCACCTT

Reverse complement sequence

AAGGTGGCTCACATTGCTAGTCACTCTTTTATTTATGCACTGTTAGTTCACTGCTGGAGAATCGCTTTTTAGTCCCAAGGTTGGGAACCCCCTATAGTTC[T/C]
GGTTTTCTAACCGGGACTACGAATCCGGGACTAAAAATGTCTATTTTTAGTCTCGGTTGAAATAACGTGGGAAACTGATTTGTAGTCCTGGTTGGTATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	28.30%	1.46%	3.89%	NA
All Indica	2759	88.60%	3.20%	2.10%	6.16%	NA
All Japonica	1512	26.40%	72.80%	0.26%	0.53%	NA
Aus	269	66.90%	32.00%	0.00%	1.12%	NA
Indica I	595	82.70%	8.20%	5.04%	4.03%	NA
Indica II	465	88.00%	1.50%	0.86%	9.68%	NA
Indica III	913	91.90%	0.20%	1.10%	6.79%	NA
Indica Intermediate	786	89.60%	3.70%	1.78%	4.96%	NA
Temperate Japonica	767	13.80%	86.00%	0.00%	0.13%	NA
Tropical Japonica	504	28.60%	69.40%	0.60%	1.39%	NA
Japonica Intermediate	241	61.80%	37.80%	0.41%	0.00%	NA
VI/Aromatic	96	63.50%	32.30%	2.08%	2.08%	NA
Intermediate	90	56.70%	36.70%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432747868	A -> DEL	N	N	silent_mutation	Average:49.333; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0432747868	A -> G	LOC_Os04g55060.1	downstream_gene_variant ; 1363.0bp to feature; MODIFIER	silent_mutation	Average:49.333; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0432747868	A -> G	LOC_Os04g55070.1	intron_variant ; MODIFIER	silent_mutation	Average:49.333; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432747868	NA	5.81E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	NA	2.09E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	5.95E-06	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	1.42E-06	5.46E-08	mr1116	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	NA	2.37E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	NA	1.70E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	6.68E-06	NA	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	1.03E-06	5.05E-06	mr1720	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	NA	1.25E-06	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	4.76E-06	7.52E-07	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	NA	1.81E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	NA	2.39E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868	NA	1.07E-06	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251