\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432747868:

Variant ID: vg0432747868 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32747868
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATACCAACCAGGACTACAAATCAGTTTCCCACGTTATTTCAACCGAGACTAAAAATAGACATTTTTAGTCCCGGATTCGTAGTCCCGGTTAGAAAACC[A/G]
GAACTATAGGGGGTTCCCAACCTTGGGACTAAAAAGCGATTCTCCAGCAGTGAACTAACAGTGCATAAATAAAAGAGTGACTAGCAATGTGAGCCACCTT

Reverse complement sequence

AAGGTGGCTCACATTGCTAGTCACTCTTTTATTTATGCACTGTTAGTTCACTGCTGGAGAATCGCTTTTTAGTCCCAAGGTTGGGAACCCCCTATAGTTC[T/C]
GGTTTTCTAACCGGGACTACGAATCCGGGACTAAAAATGTCTATTTTTAGTCTCGGTTGAAATAACGTGGGAAACTGATTTGTAGTCCTGGTTGGTATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 28.30% 1.46% 3.89% NA
All Indica  2759 88.60% 3.20% 2.10% 6.16% NA
All Japonica  1512 26.40% 72.80% 0.26% 0.53% NA
Aus  269 66.90% 32.00% 0.00% 1.12% NA
Indica I  595 82.70% 8.20% 5.04% 4.03% NA
Indica II  465 88.00% 1.50% 0.86% 9.68% NA
Indica III  913 91.90% 0.20% 1.10% 6.79% NA
Indica Intermediate  786 89.60% 3.70% 1.78% 4.96% NA
Temperate Japonica  767 13.80% 86.00% 0.00% 0.13% NA
Tropical Japonica  504 28.60% 69.40% 0.60% 1.39% NA
Japonica Intermediate  241 61.80% 37.80% 0.41% 0.00% NA
VI/Aromatic  96 63.50% 32.30% 2.08% 2.08% NA
Intermediate  90 56.70% 36.70% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432747868 A -> DEL N N silent_mutation Average:49.333; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0432747868 A -> G LOC_Os04g55060.1 downstream_gene_variant ; 1363.0bp to feature; MODIFIER silent_mutation Average:49.333; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0432747868 A -> G LOC_Os04g55070.1 intron_variant ; MODIFIER silent_mutation Average:49.333; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432747868 NA 5.81E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 NA 2.09E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 5.95E-06 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 1.42E-06 5.46E-08 mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 NA 2.37E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 NA 1.70E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 6.68E-06 NA mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 1.03E-06 5.05E-06 mr1720 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 NA 1.25E-06 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 4.76E-06 7.52E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 NA 1.81E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 NA 2.39E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432747868 NA 1.07E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251