\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432735842:

Variant ID: vg0432735842 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32735842
Reference Allele: GAlternative Allele: T,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.13, A: 0.00, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCGATGAGAAAGGGTCAGAATATACATCCTCTATAACTCAGATCGACGGAAACACGTGTGTTACATCTGAAACACATCCCTCTTTCGATGAGAAAGG[G/T,A]
TCAGAATATACATCCTCTATAACTCAGATCGACTGAAACACGTGTGGTACATCTGAAACACACCACACTGAAAAACTATCCATCTGCGCAAAACCCAAGA

Reverse complement sequence

TCTTGGGTTTTGCGCAGATGGATAGTTTTTCAGTGTGGTGTGTTTCAGATGTACCACACGTGTTTCAGTCGATCTGAGTTATAGAGGATGTATATTCTGA[C/A,T]
CCTTTCTCATCGAAAGAGGGATGTGTTTCAGATGTAACACACGTGTTTCCGTCGATCTGAGTTATAGAGGATGTATATTCTGACCCTTTCTCATCGAAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 34.40% 0.21% 0.00% A: 0.91%
All Indica  2759 95.60% 2.80% 0.11% 0.00% A: 1.56%
All Japonica  1512 8.70% 91.10% 0.20% 0.00% NA
Aus  269 64.30% 35.70% 0.00% 0.00% NA
Indica I  595 93.90% 5.70% 0.34% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 96.30% 0.40% 0.00% 0.00% A: 3.29%
Indica Intermediate  786 94.30% 3.90% 0.13% 0.00% A: 1.65%
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 23.00% 77.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 95.00% 1.24% 0.00% NA
VI/Aromatic  96 59.40% 38.50% 2.08% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432735842 G -> A LOC_Os04g55040.1 downstream_gene_variant ; 270.0bp to feature; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> A LOC_Os04g55050.1 downstream_gene_variant ; 716.0bp to feature; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> A LOC_Os04g55040.2 downstream_gene_variant ; 1893.0bp to feature; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> A LOC_Os04g55050.2 downstream_gene_variant ; 716.0bp to feature; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> A LOC_Os04g55040-LOC_Os04g55050 intergenic_region ; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> T LOC_Os04g55040.1 downstream_gene_variant ; 270.0bp to feature; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> T LOC_Os04g55050.1 downstream_gene_variant ; 716.0bp to feature; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> T LOC_Os04g55040.2 downstream_gene_variant ; 1893.0bp to feature; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> T LOC_Os04g55050.2 downstream_gene_variant ; 716.0bp to feature; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N
vg0432735842 G -> T LOC_Os04g55040-LOC_Os04g55050 intergenic_region ; MODIFIER silent_mutation Average:84.2; most accessible tissue: Zhenshan97 root, score: 93.618 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432735842 G A -0.06 -0.05 -0.03 -0.04 -0.04 -0.02
vg0432735842 G T -0.03 -0.01 0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432735842 NA 4.09E-09 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 3.45E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 1.98E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 3.16E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 2.87E-17 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 1.07E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 7.84E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 3.85E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 5.48E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 2.90E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 1.71E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 2.50E-07 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 1.12E-19 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 2.66E-07 2.26E-09 mr1498_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 2.14E-06 4.23E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 2.91E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 2.71E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432735842 NA 9.56E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251