\
| Variant ID: vg0432732386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32732386 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACTTTCTATCACATCACATCACATTGAAAACTTTTCTATACACATAAACTACCAACTTTTTCTCTAAACTATCAACTTTCTCCTAACTTCTCAACTTTT[T/C]
CACCATCTAAACACAGTCTTCATAATGTGCGCATAATTCTTATATTTAAATCGGAGCTCTTGTTGGACACGTTTTTATGGAATGACCGGATTGATTTCAT
ATGAAATCAATCCGGTCATTCCATAAAAACGTGTCCAACAAGAGCTCCGATTTAAATATAAGAATTATGCGCACATTATGAAGACTGTGTTTAGATGGTG[A/G]
AAAAGTTGAGAAGTTAGGAGAAAGTTGATAGTTTAGAGAAAAAGTTGGTAGTTTATGTGTATAGAAAAGTTTTCAATGTGATGTGATGTGATAGAAAGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.60% | 20.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 45.00% | 55.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 18.40% | 81.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432732386 | T -> C | LOC_Os04g55040.1 | upstream_gene_variant ; 212.0bp to feature; MODIFIER | silent_mutation | Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 | N | N | N | N |
| vg0432732386 | T -> C | LOC_Os04g55040.2 | upstream_gene_variant ; 212.0bp to feature; MODIFIER | silent_mutation | Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 | N | N | N | N |
| vg0432732386 | T -> C | LOC_Os04g55030.1 | downstream_gene_variant ; 1618.0bp to feature; MODIFIER | silent_mutation | Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 | N | N | N | N |
| vg0432732386 | T -> C | LOC_Os04g55050.1 | downstream_gene_variant ; 4172.0bp to feature; MODIFIER | silent_mutation | Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 | N | N | N | N |
| vg0432732386 | T -> C | LOC_Os04g55050.2 | downstream_gene_variant ; 4172.0bp to feature; MODIFIER | silent_mutation | Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 | N | N | N | N |
| vg0432732386 | T -> C | LOC_Os04g55030-LOC_Os04g55040 | intergenic_region ; MODIFIER | silent_mutation | Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432732386 | NA | 1.26E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | 4.85E-07 | NA | mr1079 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | 6.28E-06 | NA | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | NA | 2.69E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | 5.44E-06 | NA | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | NA | 1.94E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | 1.10E-06 | NA | mr1490 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | 2.49E-06 | NA | mr1490 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | NA | 7.47E-06 | mr1509 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | NA | 5.82E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432732386 | NA | 2.28E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |