\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432732386:

Variant ID: vg0432732386 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32732386
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTTTCTATCACATCACATCACATTGAAAACTTTTCTATACACATAAACTACCAACTTTTTCTCTAAACTATCAACTTTCTCCTAACTTCTCAACTTTT[T/C]
CACCATCTAAACACAGTCTTCATAATGTGCGCATAATTCTTATATTTAAATCGGAGCTCTTGTTGGACACGTTTTTATGGAATGACCGGATTGATTTCAT

Reverse complement sequence

ATGAAATCAATCCGGTCATTCCATAAAAACGTGTCCAACAAGAGCTCCGATTTAAATATAAGAATTATGCGCACATTATGAAGACTGTGTTTAGATGGTG[A/G]
AAAAGTTGAGAAGTTAGGAGAAAGTTGATAGTTTAGAGAAAAAGTTGGTAGTTTATGTGTATAGAAAAGTTTTCAATGTGATGTGATGTGATAGAAAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 20.30% 0.02% 0.00% NA
All Indica  2759 98.70% 1.30% 0.04% 0.00% NA
All Japonica  1512 45.00% 55.00% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 97.30% 2.50% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 18.40% 81.60% 0.00% 0.00% NA
Tropical Japonica  504 69.80% 30.20% 0.00% 0.00% NA
Japonica Intermediate  241 78.00% 22.00% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432732386 T -> C LOC_Os04g55040.1 upstream_gene_variant ; 212.0bp to feature; MODIFIER silent_mutation Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 N N N N
vg0432732386 T -> C LOC_Os04g55040.2 upstream_gene_variant ; 212.0bp to feature; MODIFIER silent_mutation Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 N N N N
vg0432732386 T -> C LOC_Os04g55030.1 downstream_gene_variant ; 1618.0bp to feature; MODIFIER silent_mutation Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 N N N N
vg0432732386 T -> C LOC_Os04g55050.1 downstream_gene_variant ; 4172.0bp to feature; MODIFIER silent_mutation Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 N N N N
vg0432732386 T -> C LOC_Os04g55050.2 downstream_gene_variant ; 4172.0bp to feature; MODIFIER silent_mutation Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 N N N N
vg0432732386 T -> C LOC_Os04g55030-LOC_Os04g55040 intergenic_region ; MODIFIER silent_mutation Average:84.198; most accessible tissue: Minghui63 root, score: 95.016 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432732386 NA 1.26E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 4.85E-07 NA mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 6.28E-06 NA mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 NA 2.69E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 5.44E-06 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 NA 1.94E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 1.10E-06 NA mr1490 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 2.49E-06 NA mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 NA 7.47E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 NA 5.82E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432732386 NA 2.28E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251