\
| Variant ID: vg0432718715 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32718715 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCAAGTTAGCACCCCGCTACATCGGCCCCTACCTCATAACCGCCAGACGTGGCGAAGTGGCTTATCAGCTTGAGTTACCTGAAGGTCTCGCAGATGTGCA[T/C]
AACGTGTTTCACGTATCCCAGTTAAAGAAATGTCTTCGAGTTCCAGAAGAGCAAGTTCCCCTGGGTAATATCGTGCTGGAAAAGAATCTGACCTACAAGG
CCTTGTAGGTCAGATTCTTTTCCAGCACGATATTACCCAGGGGAACTTGCTCTTCTGGAACTCGAAGACATTTCTTTAACTGGGATACGTGAAACACGTT[A/G]
TGCACATCTGCGAGACCTTCAGGTAACTCAAGCTGATAAGCCACTTCGCCACGTCTGGCGGTTATGAGGTAGGGGCCGATGTAGCGGGGTGCTAACTTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.50% | 2.40% | 5.56% | 70.59% | NA |
| All Indica | 2759 | 3.90% | 3.20% | 5.55% | 87.35% | NA |
| All Japonica | 1512 | 53.10% | 0.80% | 5.16% | 40.94% | NA |
| Aus | 269 | 25.30% | 1.90% | 6.69% | 66.17% | NA |
| Indica I | 595 | 4.00% | 3.00% | 4.20% | 88.74% | NA |
| Indica II | 465 | 6.90% | 2.20% | 5.16% | 85.81% | NA |
| Indica III | 913 | 1.60% | 4.30% | 6.79% | 87.29% | NA |
| Indica Intermediate | 786 | 4.60% | 2.80% | 5.34% | 87.28% | NA |
| Temperate Japonica | 767 | 76.70% | 0.30% | 6.26% | 16.82% | NA |
| Tropical Japonica | 504 | 31.20% | 1.60% | 4.96% | 62.30% | NA |
| Japonica Intermediate | 241 | 24.10% | 0.80% | 2.07% | 73.03% | NA |
| VI/Aromatic | 96 | 10.40% | 4.20% | 9.38% | 76.04% | NA |
| Intermediate | 90 | 30.00% | 2.20% | 5.56% | 62.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432718715 | T -> C | LOC_Os04g55020.1 | synonymous_variant ; p.His1680His; LOW | synonymous_codon | Average:8.073; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0432718715 | T -> DEL | LOC_Os04g55020.1 | N | frameshift_variant | Average:8.073; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432718715 | 3.87E-06 | 1.94E-07 | mr1022 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | NA | 7.43E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | 8.74E-07 | NA | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | NA | 5.39E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | 3.90E-06 | 1.94E-07 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | NA | 3.91E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | NA | 7.17E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | 4.79E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | 6.29E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | 4.79E-06 | NA | mr1491 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | NA | 3.83E-06 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | NA | 5.15E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432718715 | NA | 7.63E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |