\
| Variant ID: vg0432714610 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32714610 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAACGCCTCCCTTCCCCACCTCATGTGGAAAACAACATGCAACACTTAATGGCAGTTCAGACACAAATCTTGCAAGGAATAGCCGCAGCCGTAGCCGGTT[A/T]
TCAGCATAATGCTCATGGAAATGGCCACCCTCACATGGGCAACAATAGATCCAAGCTGACGGATTTTCTGAGGTCACGTCCGCCAGAGTTCTCTCAGACC
GGTCTGAGAGAACTCTGGCGGACGTGACCTCAGAAAATCCGTCAGCTTGGATCTATTGTTGCCCATGTGAGGGTGGCCATTTCCATGAGCATTATGCTGA[T/A]
AACCGGCTACGGCTGCGGCTATTCCTTGCAAGATTTGTGTCTGAACTGCCATTAAGTGTTGCATGTTGTTTTCCACATGAGGTGGGGAAGGGAGGCGTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.50% | 0.30% | 11.45% | 64.75% | NA |
| All Indica | 2759 | 5.00% | 0.40% | 16.20% | 78.40% | NA |
| All Japonica | 1512 | 55.00% | 0.00% | 1.39% | 43.65% | NA |
| Aus | 269 | 33.80% | 0.40% | 17.84% | 47.96% | NA |
| Indica I | 595 | 5.00% | 0.00% | 4.37% | 90.59% | NA |
| Indica II | 465 | 5.20% | 1.50% | 21.94% | 71.40% | NA |
| Indica III | 913 | 3.60% | 0.10% | 22.34% | 73.93% | NA |
| Indica Intermediate | 786 | 6.50% | 0.40% | 14.63% | 78.50% | NA |
| Temperate Japonica | 767 | 78.50% | 0.00% | 0.26% | 21.25% | NA |
| Tropical Japonica | 504 | 33.10% | 0.00% | 1.79% | 65.08% | NA |
| Japonica Intermediate | 241 | 25.70% | 0.00% | 4.15% | 70.12% | NA |
| VI/Aromatic | 96 | 24.00% | 0.00% | 15.62% | 60.42% | NA |
| Intermediate | 90 | 32.20% | 1.10% | 11.11% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432714610 | A -> DEL | LOC_Os04g55020.1 | N | frameshift_variant | Average:8.922; most accessible tissue: Callus, score: 18.216 | N | N | N | N |
| vg0432714610 | A -> T | LOC_Os04g55020.1 | missense_variant ; p.Tyr399Phe; MODERATE | nonsynonymous_codon ; Y399F | Average:8.922; most accessible tissue: Callus, score: 18.216 | benign |
-0.23 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432714610 | 1.45E-07 | 9.76E-08 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0432714610 | NA | 1.80E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 1.57E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 5.97E-07 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 8.86E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 2.25E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 8.52E-07 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 9.54E-06 | mr1236_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 5.55E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 2.24E-07 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | 1.95E-08 | 1.35E-10 | mr1498_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 8.25E-06 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 2.37E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | 2.58E-06 | NA | mr1789_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | 2.27E-06 | 1.99E-09 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | NA | 4.48E-06 | mr1887_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432714610 | 4.75E-06 | 4.75E-06 | mr1925_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |