\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432702205:

Variant ID: vg0432702205 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32702205
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGAAATGATAAATGATTTGCATTGAAATATTATGAAAATGATTTGAGAATGATAATTTAGCATATGTATGTTTAGTTTTAAAATAAAATAAATTGTA[G/T,A]
ATATAATTACTATGTGTTTGCATGTTGAGTTTTGTGAGCTTAATTGGGTGATGCGGCATGCTTGCATGTAGGTCTTAGTAGTGCTAATAAATACTATGTT

Reverse complement sequence

AACATAGTATTTATTAGCACTACTAAGACCTACATGCAAGCATGCCGCATCACCCAATTAAGCTCACAAAACTCAACATGCAAACACATAGTAATTATAT[C/A,T]
TACAATTTATTTTATTTTAAAACTAAACATACATATGCTAAATTATCATTCTCAAATCATTTTCATAATATTTCAATGCAAATCATTTATCATTTCTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 3.20% 2.62% 0.40% A: 0.11%
All Indica  2759 99.70% 0.10% 0.07% 0.00% A: 0.18%
All Japonica  1512 81.40% 9.60% 7.94% 1.06% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.00% 0.22% 0.00% A: 0.22%
Indica III  913 99.60% 0.00% 0.00% 0.00% A: 0.44%
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 86.70% 5.20% 7.56% 0.52% NA
Tropical Japonica  504 92.50% 4.80% 2.18% 0.60% NA
Japonica Intermediate  241 41.50% 33.60% 21.16% 3.73% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 3.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432702205 G -> DEL N N silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0432702205 G -> A LOC_Os04g54970.1 upstream_gene_variant ; 4293.0bp to feature; MODIFIER silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0432702205 G -> A LOC_Os04g54980.1 upstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0432702205 G -> A LOC_Os04g55000.1 upstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0432702205 G -> A LOC_Os04g54990.1 intron_variant ; MODIFIER silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0432702205 G -> T LOC_Os04g54970.1 upstream_gene_variant ; 4293.0bp to feature; MODIFIER silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0432702205 G -> T LOC_Os04g54980.1 upstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0432702205 G -> T LOC_Os04g55000.1 upstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0432702205 G -> T LOC_Os04g54990.1 intron_variant ; MODIFIER silent_mutation Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432702205 NA 8.79E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 1.87E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 3.46E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 4.58E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 2.76E-09 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 2.93E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 4.71E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 1.38E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 2.14E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 7.17E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 8.20E-08 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 1.03E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 9.12E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 1.01E-11 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 4.02E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 5.81E-08 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 2.37E-07 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 4.26E-06 NA mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 6.58E-06 2.80E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 3.65E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 5.38E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 6.43E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 6.30E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 3.77E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 2.50E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 1.46E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 5.76E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 2.26E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 1.37E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432702205 NA 9.44E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251