\
| Variant ID: vg0432702205 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32702205 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
TGGAGAAATGATAAATGATTTGCATTGAAATATTATGAAAATGATTTGAGAATGATAATTTAGCATATGTATGTTTAGTTTTAAAATAAAATAAATTGTA[G/T,A]
ATATAATTACTATGTGTTTGCATGTTGAGTTTTGTGAGCTTAATTGGGTGATGCGGCATGCTTGCATGTAGGTCTTAGTAGTGCTAATAAATACTATGTT
AACATAGTATTTATTAGCACTACTAAGACCTACATGCAAGCATGCCGCATCACCCAATTAAGCTCACAAAACTCAACATGCAAACACATAGTAATTATAT[C/A,T]
TACAATTTATTTTATTTTAAAACTAAACATACATATGCTAAATTATCATTCTCAAATCATTTTCATAATATTTCAATGCAAATCATTTATCATTTCTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 3.20% | 2.62% | 0.40% | A: 0.11% |
| All Indica | 2759 | 99.70% | 0.10% | 0.07% | 0.00% | A: 0.18% |
| All Japonica | 1512 | 81.40% | 9.60% | 7.94% | 1.06% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.22% | 0.00% | A: 0.22% |
| Indica III | 913 | 99.60% | 0.00% | 0.00% | 0.00% | A: 0.44% |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 86.70% | 5.20% | 7.56% | 0.52% | NA |
| Tropical Japonica | 504 | 92.50% | 4.80% | 2.18% | 0.60% | NA |
| Japonica Intermediate | 241 | 41.50% | 33.60% | 21.16% | 3.73% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 3.30% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432702205 | G -> DEL | N | N | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0432702205 | G -> A | LOC_Os04g54970.1 | upstream_gene_variant ; 4293.0bp to feature; MODIFIER | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0432702205 | G -> A | LOC_Os04g54980.1 | upstream_gene_variant ; 1359.0bp to feature; MODIFIER | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0432702205 | G -> A | LOC_Os04g55000.1 | upstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0432702205 | G -> A | LOC_Os04g54990.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0432702205 | G -> T | LOC_Os04g54970.1 | upstream_gene_variant ; 4293.0bp to feature; MODIFIER | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0432702205 | G -> T | LOC_Os04g54980.1 | upstream_gene_variant ; 1359.0bp to feature; MODIFIER | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0432702205 | G -> T | LOC_Os04g55000.1 | upstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0432702205 | G -> T | LOC_Os04g54990.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.782; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432702205 | NA | 8.79E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 1.87E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 3.46E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | 4.58E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 2.76E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 2.93E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 4.71E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 1.38E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 2.14E-07 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 7.17E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 8.20E-08 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 1.03E-07 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | 9.12E-06 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 1.01E-11 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 4.02E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | 5.81E-08 | NA | mr1745 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 2.37E-07 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | 4.26E-06 | NA | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | 6.58E-06 | 2.80E-08 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 3.65E-06 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 5.38E-07 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 6.43E-09 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 6.30E-08 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 3.77E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 2.50E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 1.46E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 5.76E-07 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 2.26E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 1.37E-08 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432702205 | NA | 9.44E-06 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |