\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432698675:

Variant ID: vg0432698675 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32698675
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCGGTACTCCACTTATATAAATCATGATTTGTAATTGGCATCCATGCACGGATATATCATAGTTGGGTTGGTCTTCGTTGAGCTTAGATACATGTGGG[G/A]
AAATGAGAAATCGACAACTTCATTACATTGTTCTAGGTGTCATTTCCATATCCATACGTAAAGAGAGACTTTATCACTTTTGTGAGACCACCTTTTGTTT

Reverse complement sequence

AAACAAAAGGTGGTCTCACAAAAGTGATAAAGTCTCTCTTTACGTATGGATATGGAAATGACACCTAGAACAATGTAATGAAGTTGTCGATTTCTCATTT[C/T]
CCCACATGTATCTAAGCTCAACGAAGACCAACCCAACTATGATATATCCGTGCATGGATGCCAATTACAAATCATGATTTATATAAGTGGAGTACCGAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 25.10% 0.02% 0.00% NA
All Indica  2759 98.40% 1.50% 0.04% 0.00% NA
All Japonica  1512 31.00% 69.00% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.70% 0.13% 0.00% NA
Temperate Japonica  767 22.60% 77.40% 0.00% 0.00% NA
Tropical Japonica  504 29.60% 70.40% 0.00% 0.00% NA
Japonica Intermediate  241 60.60% 39.40% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432698675 G -> A LOC_Os04g54970.1 upstream_gene_variant ; 763.0bp to feature; MODIFIER silent_mutation Average:46.643; most accessible tissue: Callus, score: 80.702 N N N N
vg0432698675 G -> A LOC_Os04g54990.1 upstream_gene_variant ; 2849.0bp to feature; MODIFIER silent_mutation Average:46.643; most accessible tissue: Callus, score: 80.702 N N N N
vg0432698675 G -> A LOC_Os04g55000.1 upstream_gene_variant ; 4590.0bp to feature; MODIFIER silent_mutation Average:46.643; most accessible tissue: Callus, score: 80.702 N N N N
vg0432698675 G -> A LOC_Os04g54980.1 downstream_gene_variant ; 33.0bp to feature; MODIFIER silent_mutation Average:46.643; most accessible tissue: Callus, score: 80.702 N N N N
vg0432698675 G -> A LOC_Os04g54970-LOC_Os04g54980 intergenic_region ; MODIFIER silent_mutation Average:46.643; most accessible tissue: Callus, score: 80.702 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432698675 NA 3.26E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 2.32E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 3.91E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 3.22E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 3.78E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 3.13E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 2.68E-06 mr1075_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 2.88E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 2.31E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 1.15E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 1.26E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 3.14E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 4.77E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432698675 NA 1.04E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251