| Variant ID: vg0432694084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32694084 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 286. )
GTTTGATTACATGGGGTTCGGGTCTATTTATACCCGAGAATTACAAAGTATGTCCATATCAGACACGATTCTTATCTCTAACAAACTCTAGGATATCATA[A/G]
GTTTTTGCGGCAGATTTTTGACCACACATATCTCTAAGGAATTAACATAAAATATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCATGCG
CGCATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTTAATTCCTTAGAGATATGTGTGGTCAAAAATCTGCCGCAAAAAC[T/C]
TATGATATCCTAGAGTTTGTTAGAGATAAGAATCGTGTCTGATATGGACATACTTTGTAATTCTCGGGTATAAATAGACCCGAACCCCATGTAATCAAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 83.10% | 16.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 52.30% | 47.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432694084 | A -> G | LOC_Os04g54960.1 | upstream_gene_variant ; 1431.0bp to feature; MODIFIER | silent_mutation | Average:31.066; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0432694084 | A -> G | LOC_Os04g54970.1 | downstream_gene_variant ; 2526.0bp to feature; MODIFIER | silent_mutation | Average:31.066; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0432694084 | A -> G | LOC_Os04g54980.1 | downstream_gene_variant ; 4624.0bp to feature; MODIFIER | silent_mutation | Average:31.066; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0432694084 | A -> G | LOC_Os04g54960-LOC_Os04g54970 | intergenic_region ; MODIFIER | silent_mutation | Average:31.066; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432694084 | NA | 3.78E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | NA | 7.10E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | NA | 3.86E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | 9.08E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | NA | 3.06E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | NA | 6.11E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | NA | 9.35E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | NA | 7.40E-08 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | NA | 5.05E-08 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432694084 | NA | 2.81E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/