\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432694084:

Variant ID: vg0432694084 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32694084
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTGATTACATGGGGTTCGGGTCTATTTATACCCGAGAATTACAAAGTATGTCCATATCAGACACGATTCTTATCTCTAACAAACTCTAGGATATCATA[A/G]
GTTTTTGCGGCAGATTTTTGACCACACATATCTCTAAGGAATTAACATAAAATATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCATGCG

Reverse complement sequence

CGCATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTTAATTCCTTAGAGATATGTGTGGTCAAAAATCTGCCGCAAAAAC[T/C]
TATGATATCCTAGAGTTTGTTAGAGATAAGAATCGTGTCTGATATGGACATACTTTGTAATTCTCGGGTATAAATAGACCCGAACCCCATGTAATCAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.80% 0.00% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 83.10% 16.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 86.00% 14.00% 0.00% 0.00% NA
Tropical Japonica  504 93.30% 6.70% 0.00% 0.00% NA
Japonica Intermediate  241 52.30% 47.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432694084 A -> G LOC_Os04g54960.1 upstream_gene_variant ; 1431.0bp to feature; MODIFIER silent_mutation Average:31.066; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0432694084 A -> G LOC_Os04g54970.1 downstream_gene_variant ; 2526.0bp to feature; MODIFIER silent_mutation Average:31.066; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0432694084 A -> G LOC_Os04g54980.1 downstream_gene_variant ; 4624.0bp to feature; MODIFIER silent_mutation Average:31.066; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0432694084 A -> G LOC_Os04g54960-LOC_Os04g54970 intergenic_region ; MODIFIER silent_mutation Average:31.066; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432694084 NA 3.78E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 7.10E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 3.86E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 9.08E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 3.06E-09 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 6.11E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 9.35E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 7.40E-08 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 5.05E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 2.81E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 2.80E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 1.25E-08 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 2.14E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 8.57E-10 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 3.33E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 9.53E-06 2.81E-13 mr1693 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 2.55E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 1.23E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 2.90E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 1.61E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 1.03E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 2.10E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 1.97E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 9.25E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 3.25E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 1.25E-07 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 5.48E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 5.95E-09 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 6.92E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694084 NA 4.33E-09 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251