\
| Variant ID: vg0432685574 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32685574 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 300. )
TTGATGTTGTGCTTAACGACAAGTGGAAATGAAAACTGGTTAAGCTCTTTTTTGTGTAGAGCTGTAGTGTGTATACTGCAAAGATTGATTTTGTGAGGCA[T/G]
GGATACAAAATGTCTCATGATTCATGATACTGGTTATATCTTAGTATTGTGCAGCAAAAGGCAGCAATGTATTCTGTAACCGTACTATCATTAGGATATG
CATATCCTAATGATAGTACGGTTACAGAATACATTGCTGCCTTTTGCTGCACAATACTAAGATATAACCAGTATCATGAATCATGAGACATTTTGTATCC[A/C]
TGCCTCACAAAATCAATCTTTGCAGTATACACACTACAGCTCTACACAAAAAAGAGCTTAACCAGTTTTCATTTCCACTTGTCGTTAAGCACAACATCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.00% | 28.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 24.10% | 75.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 66.50% | 33.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.80% | 88.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 30.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432685574 | T -> G | LOC_Os04g54960.1 | downstream_gene_variant ; 4470.0bp to feature; MODIFIER | silent_mutation | Average:53.546; most accessible tissue: Callus, score: 86.646 | N | N | N | N |
| vg0432685574 | T -> G | LOC_Os04g54940.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.546; most accessible tissue: Callus, score: 86.646 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432685574 | 1.28E-06 | 2.57E-12 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.20E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.10E-14 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.13E-15 | mr1362 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 7.07E-07 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 3.70E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 4.72E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 4.03E-11 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 8.65E-10 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.04E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.17E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.99E-11 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 4.30E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 9.90E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.46E-06 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.52E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432685574 | NA | 1.83E-07 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |