RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0432673364:

Variant ID: vg0432673364 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32673364
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

TCACTCCTTCACCGGCAACCATGCTGCTCTTGGCATGCGCCTTTGCTGTGTCACCAGCGAAGCCCTTCATCGAAAGTTGCTGGAAGAATCATAAGAAACA[T/A]
GTCAGTATTACCCTACTGTTGACGAGTAATACCGAATTACCTAAATACCATTAACATTTACAATTTTCCTTGGGGATGAACATGGAATTATAAGGTAAGA

Reverse complement sequence

TCTTACCTTATAATTCCATGTTCATCCCCAAGGAAAATTGTAAATGTTAATGGTATTTAGGTAATTCGGTATTACTCGTCAACAGTAGGGTAATACTGAC[A/T]
TGTTTCTTATGATTCTTCCAGCAACTTTCGATGAAGGGCTTCGCTGGTGACACAGCAAAGGCGCATGCCAAGAGCAGCATGGTTGCCGGTGAAGGAGTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	21.40%	0.00%	0.00%	NA
All Indica	2759	98.60%	1.40%	0.00%	0.00%	NA
All Japonica	1512	41.90%	58.10%	0.00%	0.00%	NA
Aus	269	76.20%	23.80%	0.00%	0.00%	NA
Indica I	595	97.50%	2.50%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	23.70%	76.30%	0.00%	0.00%	NA
Tropical Japonica	504	59.10%	40.90%	0.00%	0.00%	NA
Japonica Intermediate	241	63.90%	36.10%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432673364	T -> A	LOC_Os04g54920.1	upstream_gene_variant ; 4338.0bp to feature; MODIFIER	silent_mutation	Average:65.356; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0432673364	T -> A	LOC_Os04g54930.1	intron_variant ; MODIFIER	silent_mutation	Average:65.356; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432673364	7.66E-07	1.98E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	1.16E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	9.40E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	8.81E-08	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	4.38E-08	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	2.22E-07	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	6.47E-10	mr1077_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	3.92E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	2.32E-07	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432673364	NA	2.99E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 33 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0432673364:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact