Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432630242:

Variant ID: vg0432630242 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 32630242
Reference Allele: GT	Alternative Allele: AT,G
Primary Allele: GT	Secondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATCTAATATGTGGGTTTTATGATATCGGATCTCTAGCCGATGTATACTTTAACTTTCGGATCAATACTTATTCTATTATATCATACTGCTAGCCAATTG[GT/AT,G]
TTTTAATGGATTATATTATTGTTATATTTTATTATCATCAACCGATTGTCTTTATATCATTATTTACATTGGAAATATAGCCGATTGGCTTTTCAGCCGA

Reverse complement sequence

TCGGCTGAAAAGCCAATCGGCTATATTTCCAATGTAAATAATGATATAAAGACAATCGGTTGATGATAATAAAATATAACAATAATATAATCCATTAAAA[AC/AT,C]
CAATTGGCTAGCAGTATGATATAATAGAATAAGTATTGATCCGAAAGTTAAAGTATACATCGGCTAGAGATCCGATATCATAAAACCCACATATTAGATT

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	24.60%	0.11%	0.32%	NA
All Indica	2759	68.20%	31.10%	0.14%	0.51%	NA
All Japonica	1512	93.50%	6.50%	0.00%	0.07%	NA
Aus	269	35.30%	64.70%	0.00%	0.00%	NA
Indica I	595	86.40%	13.30%	0.17%	0.17%	NA
Indica II	465	59.10%	40.00%	0.43%	0.43%	NA
Indica III	913	58.90%	40.40%	0.00%	0.66%	NA
Indica Intermediate	786	70.70%	28.50%	0.13%	0.64%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	81.50%	18.30%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	16.70%	1.04%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432630242	GT -> DEL	N	N	silent_mutation	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> G	LOC_Os04g54860.1	upstream_gene_variant ; 2034.0bp to feature; MODIFIER	N	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> G	LOC_Os04g54850.1	downstream_gene_variant ; 1109.0bp to feature; MODIFIER	N	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> G	LOC_Os04g54870.1	downstream_gene_variant ; 2920.0bp to feature; MODIFIER	N	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> G	LOC_Os04g54870.2	downstream_gene_variant ; 2920.0bp to feature; MODIFIER	N	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> G	LOC_Os04g54850-LOC_Os04g54860	intergenic_region ; MODIFIER	N	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> AT	LOC_Os04g54860.1	upstream_gene_variant ; 2035.0bp to feature; MODIFIER	silent_mutation	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> AT	LOC_Os04g54850.1	downstream_gene_variant ; 1108.0bp to feature; MODIFIER	silent_mutation	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> AT	LOC_Os04g54870.1	downstream_gene_variant ; 2921.0bp to feature; MODIFIER	silent_mutation	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> AT	LOC_Os04g54870.2	downstream_gene_variant ; 2921.0bp to feature; MODIFIER	silent_mutation	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N
vg0432630242	GT -> AT	LOC_Os04g54850-LOC_Os04g54860	intergenic_region ; MODIFIER	silent_mutation	Average:37.188; most accessible tissue: Callus, score: 64.323	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432630242	9.26E-06	2.46E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	4.28E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	8.17E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	3.88E-06	7.05E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	3.27E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	6.94E-07	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	1.28E-06	9.76E-06	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	1.74E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	6.77E-07	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	6.43E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	1.99E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	5.08E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	3.01E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	8.49E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	1.21E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	2.02E-07	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	6.14E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	1.82E-06	4.05E-10	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	4.25E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	NA	2.17E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	6.70E-12	2.80E-17	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	3.61E-07	3.47E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	1.59E-11	1.75E-16	mr1800_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242	2.88E-06	NA	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251