\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432630242:

Variant ID: vg0432630242 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 32630242
Reference Allele: GTAlternative Allele: AT,G
Primary Allele: GTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCTAATATGTGGGTTTTATGATATCGGATCTCTAGCCGATGTATACTTTAACTTTCGGATCAATACTTATTCTATTATATCATACTGCTAGCCAATTG[GT/AT,G]
TTTTAATGGATTATATTATTGTTATATTTTATTATCATCAACCGATTGTCTTTATATCATTATTTACATTGGAAATATAGCCGATTGGCTTTTCAGCCGA

Reverse complement sequence

TCGGCTGAAAAGCCAATCGGCTATATTTCCAATGTAAATAATGATATAAAGACAATCGGTTGATGATAATAAAATATAACAATAATATAATCCATTAAAA[AC/AT,C]
CAATTGGCTAGCAGTATGATATAATAGAATAAGTATTGATCCGAAAGTTAAAGTATACATCGGCTAGAGATCCGATATCATAAAACCCACATATTAGATT

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 24.60% 0.11% 0.32% NA
All Indica  2759 68.20% 31.10% 0.14% 0.51% NA
All Japonica  1512 93.50% 6.50% 0.00% 0.07% NA
Aus  269 35.30% 64.70% 0.00% 0.00% NA
Indica I  595 86.40% 13.30% 0.17% 0.17% NA
Indica II  465 59.10% 40.00% 0.43% 0.43% NA
Indica III  913 58.90% 40.40% 0.00% 0.66% NA
Indica Intermediate  786 70.70% 28.50% 0.13% 0.64% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 18.30% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 16.70% 1.04% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432630242 GT -> DEL N N silent_mutation Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> G LOC_Os04g54860.1 upstream_gene_variant ; 2034.0bp to feature; MODIFIER N Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> G LOC_Os04g54850.1 downstream_gene_variant ; 1109.0bp to feature; MODIFIER N Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> G LOC_Os04g54870.1 downstream_gene_variant ; 2920.0bp to feature; MODIFIER N Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> G LOC_Os04g54870.2 downstream_gene_variant ; 2920.0bp to feature; MODIFIER N Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> G LOC_Os04g54850-LOC_Os04g54860 intergenic_region ; MODIFIER N Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> AT LOC_Os04g54860.1 upstream_gene_variant ; 2035.0bp to feature; MODIFIER silent_mutation Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> AT LOC_Os04g54850.1 downstream_gene_variant ; 1108.0bp to feature; MODIFIER silent_mutation Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> AT LOC_Os04g54870.1 downstream_gene_variant ; 2921.0bp to feature; MODIFIER silent_mutation Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> AT LOC_Os04g54870.2 downstream_gene_variant ; 2921.0bp to feature; MODIFIER silent_mutation Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N
vg0432630242 GT -> AT LOC_Os04g54850-LOC_Os04g54860 intergenic_region ; MODIFIER silent_mutation Average:37.188; most accessible tissue: Callus, score: 64.323 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432630242 9.26E-06 2.46E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 4.28E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 8.17E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 3.88E-06 7.05E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 3.27E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 6.94E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 1.28E-06 9.76E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 1.74E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 6.77E-07 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 6.43E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 1.99E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 5.08E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 3.01E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 8.49E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 1.21E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 2.02E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 6.14E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 1.82E-06 4.05E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 4.25E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 NA 2.17E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 6.70E-12 2.80E-17 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 3.61E-07 3.47E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 1.59E-11 1.75E-16 mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432630242 2.88E-06 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251