\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432624995:

Variant ID: vg0432624995 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32624995
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.08, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACACAATCTCACTGCAGCAAACAATATCTTCGATTATACTCCCTCCATTCTAAAATATAGGGCACAACTAATTTTTAAAGGTGTTTCATAATATAAG[A/G,T]
CGTGCATGCATGCATGACAATTAATTAGCATCTCTTCTCTTCTAAATTATTACTTTTTAAATGATACACTCACGAGATGTTTAATTCTATTGGGTGCATG

Reverse complement sequence

CATGCACCCAATAGAATTAAACATCTCGTGAGTGTATCATTTAAAAAGTAATAATTTAGAAGAGAAGAGATGCTAATTAATTGTCATGCATGCATGCACG[T/C,A]
CTTATATTATGAAACACCTTTAAAAATTAGTTGTGCCCTATATTTTAGAATGGAGGGAGTATAATCGAAGATATTGTTTGCTGCAGTGAGATTGTGTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 24.30% 0.40% 0.00% T: 0.76%
All Indica  2759 69.70% 28.50% 0.58% 0.00% T: 1.30%
All Japonica  1512 93.10% 6.80% 0.07% 0.00% NA
Aus  269 34.60% 64.70% 0.74% 0.00% NA
Indica I  595 86.70% 13.30% 0.00% 0.00% NA
Indica II  465 59.10% 40.00% 0.86% 0.00% NA
Indica III  913 61.80% 33.60% 0.66% 0.00% T: 3.94%
Indica Intermediate  786 72.10% 27.10% 0.76% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 81.20% 18.70% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432624995 A -> G LOC_Os04g54850.1 upstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:61.078; most accessible tissue: Callus, score: 89.947 N N N N
vg0432624995 A -> G LOC_Os04g54840-LOC_Os04g54850 intergenic_region ; MODIFIER silent_mutation Average:61.078; most accessible tissue: Callus, score: 89.947 N N N N
vg0432624995 A -> T LOC_Os04g54850.1 upstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:61.078; most accessible tissue: Callus, score: 89.947 N N N N
vg0432624995 A -> T LOC_Os04g54840-LOC_Os04g54850 intergenic_region ; MODIFIER silent_mutation Average:61.078; most accessible tissue: Callus, score: 89.947 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432624995 NA 8.43E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 4.97E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 2.80E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 1.98E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 8.40E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 7.94E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 7.36E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 2.70E-06 1.36E-08 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 3.33E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 1.20E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 NA 1.13E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 5.70E-11 5.38E-17 mr1800_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 3.67E-06 NA mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432624995 5.10E-09 1.12E-14 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251