\
| Variant ID: vg0432620685 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 32620685 |
| Reference Allele: CGA | Alternative Allele: TGA,C |
| Primary Allele: CGA | Secondary Allele: TGA |
Inferred Ancestral Allele: Not determined.
GTGCCAGACCACTTGCGTCGTCATGCGTCGATGTTCGTGTCATTTTCATGTAATGTTGAGCAATATAGATGGTATATTTATGCTAAAAAAAATTAAATTC[CGA/TGA,C]
GTAAAAAAATAAACTGTATATTTTTAAATTTAATTCGTTTGTACACTGCATATTGAACTAGGAAATGCTCGATTGTTCACCATGTCATAATATGATGCCC
GGGCATCATATTATGACATGGTGAACAATCGAGCATTTCCTAGTTCAATATGCAGTGTACAAACGAATTAAATTTAAAAATATACAGTTTATTTTTTTAC[TCG/TCA,G]
GAATTTAATTTTTTTTAGCATAAATATACCATCTATATTGCTCAACATTACATGAAAATGACACGAACATCGACGCATGACGACGCAAGTGGTCTGGCAC
| Populations | Population Size | Frequency of CGA(primary allele) | Frequency of TGA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 6.80% | 0.32% | 0.13% | C: 0.15% |
| All Indica | 2759 | 94.00% | 5.20% | 0.40% | 0.18% | C: 0.25% |
| All Japonica | 1512 | 93.40% | 6.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 77.70% | 21.60% | 0.37% | 0.37% | NA |
| Indica I | 595 | 96.60% | 3.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.90% | 0.22% | 0.22% | NA |
| Indica III | 913 | 89.30% | 9.10% | 0.55% | 0.44% | C: 0.66% |
| Indica Intermediate | 786 | 94.70% | 4.80% | 0.38% | 0.00% | C: 0.13% |
| Temperate Japonica | 767 | 92.20% | 7.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 14.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432620685 | CGA -> C | LOC_Os04g54840.1 | downstream_gene_variant ; 1736.0bp to feature; MODIFIER | silent_mutation | Average:54.044; most accessible tissue: Callus, score: 85.824 | N | N | N | N |
| vg0432620685 | CGA -> C | LOC_Os04g54840-LOC_Os04g54850 | intergenic_region ; MODIFIER | silent_mutation | Average:54.044; most accessible tissue: Callus, score: 85.824 | N | N | N | N |
| vg0432620685 | CGA -> DEL | N | N | silent_mutation | Average:54.044; most accessible tissue: Callus, score: 85.824 | N | N | N | N |
| vg0432620685 | CGA -> TGA | LOC_Os04g54840.1 | downstream_gene_variant ; 1735.0bp to feature; MODIFIER | silent_mutation | Average:54.044; most accessible tissue: Callus, score: 85.824 | N | N | N | N |
| vg0432620685 | CGA -> TGA | LOC_Os04g54840-LOC_Os04g54850 | intergenic_region ; MODIFIER | silent_mutation | Average:54.044; most accessible tissue: Callus, score: 85.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432620685 | NA | 5.02E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432620685 | 6.21E-06 | NA | mr1855 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432620685 | 7.35E-10 | 7.35E-10 | mr1855 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432620685 | 1.93E-06 | 5.64E-07 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |