\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432598231:

Variant ID: vg0432598231 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32598231
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.46, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGGAACTAAAATTTTTAAGTCCCTATCACATCGGATGTTTAGACACTAATTATAAATATTAAACGTAGACTATTAATAAATCCCATCCATAATCTT[A/G]
GACTAATTCGCGAGACGAATCTATTGAGCCTAATTAATCCATGATTAGCATATGTGATGCTACAGTAACCATTCTATAGTTATGAATTAATTAGGCTTAA

Reverse complement sequence

TTAAGCCTAATTAATTCATAACTATAGAATGGTTACTGTAGCATCACATATGCTAATCATGGATTAATTAGGCTCAATAGATTCGTCTCGCGAATTAGTC[T/C]
AAGATTATGGATGGGATTTATTAATAGTCTACGTTTAATATTTATAATTAGTGTCTAAACATCCGATGTGATAGGGACTTAAAAATTTTAGTTCCTTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.70% 22.20% 1.16% 53.94% NA
All Indica  2759 25.60% 3.10% 1.81% 69.52% NA
All Japonica  1512 7.00% 55.80% 0.20% 36.97% NA
Aus  269 63.90% 32.30% 0.00% 3.72% NA
Indica I  595 10.40% 7.60% 1.34% 80.67% NA
Indica II  465 16.80% 2.60% 3.23% 77.42% NA
Indica III  913 42.70% 0.20% 1.10% 55.97% NA
Indica Intermediate  786 22.30% 3.40% 2.16% 72.14% NA
Temperate Japonica  767 0.50% 90.60% 0.00% 8.87% NA
Tropical Japonica  504 18.80% 10.50% 0.40% 70.24% NA
Japonica Intermediate  241 2.90% 39.80% 0.41% 56.85% NA
VI/Aromatic  96 67.70% 10.40% 0.00% 21.88% NA
Intermediate  90 25.60% 26.70% 2.22% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432598231 A -> DEL N N silent_mutation Average:52.305; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0432598231 A -> G LOC_Os04g54810.1 upstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:52.305; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0432598231 A -> G LOC_Os04g54820.1 upstream_gene_variant ; 2078.0bp to feature; MODIFIER silent_mutation Average:52.305; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0432598231 A -> G LOC_Os04g54820.2 upstream_gene_variant ; 2078.0bp to feature; MODIFIER silent_mutation Average:52.305; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0432598231 A -> G LOC_Os04g54810-LOC_Os04g54820 intergenic_region ; MODIFIER silent_mutation Average:52.305; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432598231 A G -0.03 0.0 0.01 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432598231 NA 8.43E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 4.97E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 6.26E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 2.80E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 1.98E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 8.40E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 3.49E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 7.86E-07 3.06E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 3.30E-07 1.04E-09 mr1403 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 7.94E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 2.88E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 3.08E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 6.59E-10 1.79E-14 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 6.79E-07 2.96E-08 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 3.33E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 1.20E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 6.72E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 1.36E-06 3.74E-11 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 NA 2.67E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 8.90E-15 2.03E-24 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 4.36E-10 1.27E-11 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432598231 5.10E-09 1.12E-14 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251