\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432593833:

Variant ID: vg0432593833 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32593833
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AGTACTGGAGTAGGCTACCGGATAGACCGTGGTCAAGCTGCAAATAATTTGGTAGGTGCAACCGAAGATAAGATGCGAGGCATATGATCCTGACTCTGAA[T/A]
TGTCTCATGCCGCAGCTGGATTCTTGGGACAAAGCTTAATATGGTCTGATGTCTCCAGTTTCAAGGGAACACATGATTAGTCCATGTTATAGCTAATTCC

Reverse complement sequence

GGAATTAGCTATAACATGGACTAATCATGTGTTCCCTTGAAACTGGAGACATCAGACCATATTAAGCTTTGTCCCAAGAATCCAGCTGCGGCATGAGACA[A/T]
TTCAGAGTCAGGATCATATGCCTCGCATCTTATCTTCGGTTGCACCTACCAAATTATTTGCAGCTTGACCACGGTCTATCCGGTAGCCTACTCCAGTACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 27.20% 0.40% 0.00% NA
All Indica  2759 77.20% 22.20% 0.58% 0.00% NA
All Japonica  1512 75.70% 24.10% 0.13% 0.00% NA
Aus  269 25.30% 74.30% 0.37% 0.00% NA
Indica I  595 91.30% 8.60% 0.17% 0.00% NA
Indica II  465 83.90% 15.70% 0.43% 0.00% NA
Indica III  913 61.00% 38.00% 0.99% 0.00% NA
Indica Intermediate  786 81.60% 17.90% 0.51% 0.00% NA
Temperate Japonica  767 86.30% 13.70% 0.00% 0.00% NA
Tropical Japonica  504 74.60% 25.20% 0.20% 0.00% NA
Japonica Intermediate  241 44.40% 55.20% 0.41% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432593833 T -> A LOC_Os04g54810.1 intron_variant ; MODIFIER silent_mutation Average:77.511; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432593833 T A -0.04 -0.04 -0.03 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432593833 NA 2.80E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 NA 5.19E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 NA 3.25E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 NA 8.02E-11 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 NA 1.12E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 NA 5.00E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 3.26E-06 1.22E-11 mr1720 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 4.89E-09 3.80E-12 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 2.43E-07 8.15E-09 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 NA 3.21E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 NA 4.57E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 5.91E-06 5.99E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 7.19E-06 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 NA 1.36E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 1.07E-11 3.22E-16 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432593833 1.24E-12 2.88E-14 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251