Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432523991:

Variant ID: vg0432523991 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32523991
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ATCGAGGACTTCGATCCACCGACGGATTGTGGCTTCAAGCTCCTGTGCGGAGCGAGCACGGTCATCCAAGGCCTTGCGCTCAGCCCCGAGCGCCGTCGTT[C/G]
GAGCCTGCAGAGAGGCCTCAGCCTCCGATGCCCGCCGCTCGTGGGCAGCGGCTGCGTCAAGGACGCCGCAAGCGTCCCTAATCCTCTTCGCCAAGTCCTC

Reverse complement sequence

GAGGACTTGGCGAAGAGGATTAGGGACGCTTGCGGCGTCCTTGACGCAGCCGCTGCCCACGAGCGGCGGGCATCGGAGGCTGAGGCCTCTCTGCAGGCTC[G/C]
AACGACGGCGCTCGGGGCTGAGCGCAAGGCCTTGGATGACCGTGCTCGCTCCGCACAGGAGCTTGAAGCCACAATCCGTCGGTGGATCGAAGTCCTCGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.40%	16.50%	0.11%	0.00%	NA
All Indica	2759	81.20%	18.70%	0.11%	0.00%	NA
All Japonica	1512	93.60%	6.30%	0.07%	0.00%	NA
Aus	269	40.90%	58.70%	0.37%	0.00%	NA
Indica I	595	92.10%	7.70%	0.17%	0.00%	NA
Indica II	465	85.20%	14.60%	0.22%	0.00%	NA
Indica III	913	68.90%	31.10%	0.00%	0.00%	NA
Indica Intermediate	786	84.90%	15.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	81.50%	18.30%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432523991	C -> G	LOC_Os04g54670.1	missense_variant ; p.Arg1435Pro; MODERATE	nonsynonymous_codon ; R1435P	Average:69.193; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	possibly damaging	1.979	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432523991	4.17E-06	3.20E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	NA	3.19E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	8.72E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	5.66E-06	5.47E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	6.14E-07	5.72E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	NA	4.63E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	NA	1.89E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	3.31E-08	2.02E-06	mr1411	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	NA	2.45E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	1.20E-07	1.50E-11	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	7.48E-09	1.79E-10	mr1800	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	NA	7.50E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	NA	8.62E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	NA	9.73E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	7.58E-06	NA	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	NA	4.07E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	2.47E-12	2.48E-19	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	4.92E-11	3.85E-12	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	1.30E-07	2.17E-11	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432523991	4.68E-06	NA	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251