\
| Variant ID: vg0432523918 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32523918 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 76. )
GCGCTCGCTCCTCCAGCTCCTGGGCCCGCCCCGTCTGTTCTTCGCCGCACGTTTTTTGCTCGCGCTGGTTTCGATCGAGGACTTCGATCCACCGACGGAT[T/C]
GTGGCTTCAAGCTCCTGTGCGGAGCGAGCACGGTCATCCAAGGCCTTGCGCTCAGCCCCGAGCGCCGTCGTTCGAGCCTGCAGAGAGGCCTCAGCCTCCG
CGGAGGCTGAGGCCTCTCTGCAGGCTCGAACGACGGCGCTCGGGGCTGAGCGCAAGGCCTTGGATGACCGTGCTCGCTCCGCACAGGAGCTTGAAGCCAC[A/G]
ATCCGTCGGTGGATCGAAGTCCTCGATCGAAACCAGCGCGAGCAAAAAACGTGCGGCGAAGAACAGACGGGGCGGGCCCAGGAGCTGGAGGAGCGAGCGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.70% | 32.80% | 0.40% | 0.13% | NA |
| All Indica | 2759 | 73.10% | 26.40% | 0.33% | 0.22% | NA |
| All Japonica | 1512 | 64.50% | 35.00% | 0.53% | 0.00% | NA |
| Aus | 269 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.00% | 25.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 56.60% | 42.30% | 0.66% | 0.44% | NA |
| Indica Intermediate | 786 | 77.50% | 22.00% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 72.80% | 26.30% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 32.40% | 67.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 34.40% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432523918 | T -> C | LOC_Os04g54670.1 | synonymous_variant ; p.Thr1459Thr; LOW | synonymous_codon | Average:70.549; most accessible tissue: Minghui63 young leaf, score: 84.596 | N | N | N | N |
| vg0432523918 | T -> DEL | LOC_Os04g54670.1 | N | frameshift_variant | Average:70.549; most accessible tissue: Minghui63 young leaf, score: 84.596 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432523918 | NA | 4.36E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 9.12E-08 | 9.46E-11 | mr1800 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 2.85E-07 | 5.41E-09 | mr1800 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | NA | 2.13E-06 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | NA | 9.82E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 1.20E-06 | 1.14E-09 | mr1740_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 6.36E-09 | 4.81E-12 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 2.11E-08 | NA | mr1771_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 4.62E-07 | NA | mr1771_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 3.94E-09 | NA | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 3.61E-08 | 6.67E-08 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 4.86E-06 | 1.51E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 3.77E-16 | 1.22E-19 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 1.69E-11 | 2.48E-12 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432523918 | 2.56E-07 | NA | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |