\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432522122:

Variant ID: vg0432522122 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32522122
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCTTGCCAATGTGGGAAGGACCATACAAAGTGATCGGAGTGCCCCGGCCAGGCTCCGTTCGGTTAACCACGGAGGACGGCACAGAGCTGCCCAACCCC[T/G]
GGAATATCGAGCACCTCCGTCGTTTCTATCCATAAAATCGAGATTTTTTGCTTTCCTGGAGCTCAGGCCAGCACCCGCACAACCCCTCGGTTTGTGCGGG

Reverse complement sequence

CCCGCACAAACCGAGGGGTTGTGCGGGTGCTGGCCTGAGCTCCAGGAAAGCAAAAAATCTCGATTTTATGGATAGAAACGACGGAGGTGCTCGATATTCC[A/C]
GGGGTTGGGCAGCTCTGTGCCGTCCTCCGTGGTTAACCGAACGGAGCCTGGCCGGGGCACTCCGATCACTTTGTATGGTCCTTCCCACATTGGCAAGAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 12.30% 1.25% 3.22% NA
All Indica  2759 81.10% 13.30% 1.63% 4.02% NA
All Japonica  1512 93.60% 4.90% 0.40% 1.12% NA
Aus  269 39.80% 49.40% 2.97% 7.81% NA
Indica I  595 92.10% 5.20% 1.18% 1.51% NA
Indica II  465 84.90% 8.20% 1.72% 5.16% NA
Indica III  913 68.90% 21.90% 2.19% 7.01% NA
Indica Intermediate  786 84.60% 12.30% 1.27% 1.78% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 81.50% 14.50% 0.79% 3.17% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 0.00% 2.08% NA
Intermediate  90 92.20% 6.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432522122 T -> DEL LOC_Os04g54660.1 N frameshift_variant Average:57.156; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0432522122 T -> G LOC_Os04g54660.1 missense_variant ; p.Trp1152Gly; MODERATE nonsynonymous_codon ; W1152G Average:57.156; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 possibly damaging 1.803 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432522122 5.04E-06 1.94E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 1.94E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 4.85E-06 1.01E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 1.04E-06 3.91E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 8.70E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 3.80E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 1.54E-06 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 7.26E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 2.58E-06 2.72E-10 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 9.77E-07 1.15E-08 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 9.69E-07 1.46E-08 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 8.45E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 8.74E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 3.67E-06 3.68E-06 mr1382_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 5.32E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 5.94E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 4.22E-06 NA mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 1.33E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 NA 2.06E-08 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 1.50E-07 3.68E-13 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 1.81E-06 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 1.16E-06 6.56E-09 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 4.72E-16 4.45E-25 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 1.11E-13 6.69E-15 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 1.01E-07 1.51E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122 2.52E-07 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251