Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432522122:

Variant ID: vg0432522122 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32522122
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCTTGCCAATGTGGGAAGGACCATACAAAGTGATCGGAGTGCCCCGGCCAGGCTCCGTTCGGTTAACCACGGAGGACGGCACAGAGCTGCCCAACCCC[T/G]
GGAATATCGAGCACCTCCGTCGTTTCTATCCATAAAATCGAGATTTTTTGCTTTCCTGGAGCTCAGGCCAGCACCCGCACAACCCCTCGGTTTGTGCGGG

Reverse complement sequence

CCCGCACAAACCGAGGGGTTGTGCGGGTGCTGGCCTGAGCTCCAGGAAAGCAAAAAATCTCGATTTTATGGATAGAAACGACGGAGGTGCTCGATATTCC[A/C]
GGGGTTGGGCAGCTCTGTGCCGTCCTCCGTGGTTAACCGAACGGAGCCTGGCCGGGGCACTCCGATCACTTTGTATGGTCCTTCCCACATTGGCAAGAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	12.30%	1.25%	3.22%	NA
All Indica	2759	81.10%	13.30%	1.63%	4.02%	NA
All Japonica	1512	93.60%	4.90%	0.40%	1.12%	NA
Aus	269	39.80%	49.40%	2.97%	7.81%	NA
Indica I	595	92.10%	5.20%	1.18%	1.51%	NA
Indica II	465	84.90%	8.20%	1.72%	5.16%	NA
Indica III	913	68.90%	21.90%	2.19%	7.01%	NA
Indica Intermediate	786	84.60%	12.30%	1.27%	1.78%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	81.50%	14.50%	0.79%	3.17%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	94.80%	3.10%	0.00%	2.08%	NA
Intermediate	90	92.20%	6.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432522122	T -> DEL	LOC_Os04g54660.1	N	frameshift_variant	Average:57.156; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0432522122	T -> G	LOC_Os04g54660.1	missense_variant ; p.Trp1152Gly; MODERATE	nonsynonymous_codon ; W1152G	Average:57.156; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	possibly damaging	1.803	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432522122	5.04E-06	1.94E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	1.94E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	4.85E-06	1.01E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	1.04E-06	3.91E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	8.70E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	3.80E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	1.54E-06	NA	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	7.26E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	2.58E-06	2.72E-10	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	9.77E-07	1.15E-08	mr1800	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	9.69E-07	1.46E-08	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	8.45E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	8.74E-06	mr1253_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	3.67E-06	3.68E-06	mr1382_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	5.32E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	5.94E-06	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	4.22E-06	NA	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	1.33E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	NA	2.06E-08	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	1.50E-07	3.68E-13	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	1.81E-06	NA	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	1.16E-06	6.56E-09	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	4.72E-16	4.45E-25	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	1.11E-13	6.69E-15	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	1.01E-07	1.51E-10	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432522122	2.52E-07	NA	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251