Search for Variation information by Variation ID:
Detailed information for vg0432518407:
| Variant ID: vg0432518407 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32518407 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )
Flanking Sequence (100 bp) in Reference Genome:
ACATCGTCGGGGGCCACAGGAAGCCGAAGGCGTCATGACGGCCTCTACGGTACGCAGGACGCTCGAATCAACATCGAGCGACGCCGGGATGAGCGCCGAG[T/C]
TGCCCGTATGGGGGAAGGTGCCTCCTCATCTGGAGCGTCACGCTCCTCTTCGCGAGGCGGCCCTCCTCCCACACTCACCCCTGGGGGAACATGTTGTAGG
Reverse complement sequence
CCTACAACATGTTCCCCCAGGGGTGAGTGTGGGAGGAGGGCCGCCTCGCGAAGAGGAGCGTGACGCTCCAGATGAGGAGGCACCTTCCCCCATACGGGCA[A/G]
CTCGGCGCTCATCCCGGCGTCGCTCGATGTTGATTCGAGCGTCCTGCGTACCGTAGAGGCCGTCATGACGCCTTCGGCTTCCTGTGGCCCCCGACGATGT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 10.50% | 1.90% | 0.91% | NA |
| All Indica | 2759 | 96.00% | 1.40% | 1.05% | 1.52% | NA |
| All Japonica | 1512 | 66.90% | 29.40% | 3.64% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 93.10% | 5.20% | 1.68% | 0.00% | NA |
| Indica II | 465 | 92.70% | 0.60% | 1.29% | 5.38% | NA |
| Indica III | 913 | 98.70% | 0.00% | 0.44% | 0.88% | NA |
| Indica Intermediate | 786 | 96.90% | 0.80% | 1.15% | 1.15% | NA |
| Temperate Japonica | 767 | 39.00% | 54.60% | 6.39% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 7.50% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 10.00% | 4.44% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432518407 | T -> C | LOC_Os04g54660.1 | missense_variant ; p.Val153Ala; MODERATE | nonsynonymous_codon ; V153A | Average:60.604; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | benign  |
-1.453 |
TOLERATED | 1.00 |
| vg0432518407 | T -> DEL | LOC_Os04g54660.1 | N | frameshift_variant | Average:60.604; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432518407 | 6.85E-08 | 2.22E-16 | mr1013_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432518407 | NA | 2.98E-08 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432518407 | 6.10E-06 | NA | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432518407 | NA | 8.43E-08 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432518407 | NA | 9.43E-08 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432518407 | NA | 6.26E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432518407 | NA | 3.22E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432518407 | NA | 6.51E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432518407 | NA | 6.88E-10 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |