\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432449081:

Variant ID: vg0432449081 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32449081
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, G: 0.14, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CATCCTGATCGGCTCCGTCCGCCTCGGCTTCCCCCAACCAAAGTCGCCGACGTCGTACGGCCGGAACGCCGGCGAGCCAGACACGTTCATCGCCCTCTCC[G/A]
TGACGGGGACCAGCGTCTCCATCAGCCTCAAGAAATCCCACCCGGCGAGCGGGTCTTCGGCCACCTTGGCGATCTCCTCCTGGATCGCCGACGCCGCGGC

Reverse complement sequence

GCCGCGGCGTCGGCGATCCAGGAGGAGATCGCCAAGGTGGCCGAAGACCCGCTCGCCGGGTGGGATTTCTTGAGGCTGATGGAGACGCTGGTCCCCGTCA[C/T]
GGAGAGGGCGATGAACGTGTCTGGCTCGCCGGCGTTCCGGCCGTACGACGTCGGCGACTTTGGTTGGGGGAAGCCGAGGCGGACGGAGCCGATCAGGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 20.60% 0.08% 0.00% NA
All Indica  2759 96.70% 3.20% 0.04% 0.00% NA
All Japonica  1512 47.40% 52.40% 0.20% 0.00% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 90.40% 9.60% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 25.20% 74.70% 0.13% 0.00% NA
Tropical Japonica  504 89.70% 9.90% 0.40% 0.00% NA
Japonica Intermediate  241 29.90% 70.10% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432449081 G -> A LOC_Os04g54560.1 missense_variant ; p.Thr370Met; MODERATE nonsynonymous_codon ; T370M Average:90.899; most accessible tissue: Minghui63 young leaf, score: 98.089 unknown unknown TOLERATED 0.44

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432449081 G A -0.03 -0.02 -0.01 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432449081 1.44E-07 1.44E-07 mr1736 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432449081 NA 7.17E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432449081 NA 3.64E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432449081 NA 3.67E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432449081 8.66E-06 NA mr1406_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432449081 NA 1.19E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432449081 9.59E-07 4.91E-11 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432449081 NA 5.89E-09 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432449081 NA 1.51E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251