\
| Variant ID: vg0432443461 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32443461 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACATACATCTGACAGGGGATGAACCGGGACTAAAAATCATCTTTAGTCCCGGTTGGTAAAGATCAAAAATTTTTTAACCGGGACTAAAAATCGTTTTTA[G/A]
TCCCGGTTTTTAGTGGAACCGGGACTATTGTGAGATTTGGTCGACCGACCAAAGATGGTTTCTCCACCAGTGGTTTCTTGAGGCGTTCGAGCTGCTCCGC
GCGGAGCAGCTCGAACGCCTCAAGAAACCACTGGTGGAGAAACCATCTTTGGTCGGTCGACCAAATCTCACAATAGTCCCGGTTCCACTAAAAACCGGGA[C/T]
TAAAAACGATTTTTAGTCCCGGTTAAAAAATTTTTGATCTTTACCAACCGGGACTAAAGATGATTTTTAGTCCCGGTTCATCCCCTGTCAGATGTATGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 16.30% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 81.80% | 18.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 93.70% | 6.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 36.40% | 62.50% | 1.12% | 0.00% | NA |
| Indica I | 595 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.60% | 14.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 69.30% | 30.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432443461 | G -> A | LOC_Os04g54540.1 | upstream_gene_variant ; 3983.0bp to feature; MODIFIER | silent_mutation | Average:54.622; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0432443461 | G -> A | LOC_Os04g54550.1 | downstream_gene_variant ; 1937.0bp to feature; MODIFIER | silent_mutation | Average:54.622; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0432443461 | G -> A | LOC_Os04g54540-LOC_Os04g54550 | intergenic_region ; MODIFIER | silent_mutation | Average:54.622; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432443461 | NA | 4.92E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 7.75E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 1.97E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 5.34E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 2.60E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 7.75E-06 | 5.32E-08 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 2.45E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 3.55E-07 | 1.25E-11 | mr1800 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 2.61E-08 | 1.81E-10 | mr1800 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 9.80E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 6.04E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 3.74E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 6.28E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 4.91E-08 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 1.48E-06 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 2.13E-07 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 9.00E-06 | 1.66E-08 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | NA | 2.84E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 1.63E-06 | 3.98E-10 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 5.46E-10 | 2.11E-16 | mr1741_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 8.09E-08 | NA | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 1.00E-07 | 8.91E-10 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 6.09E-18 | 7.46E-28 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 8.50E-14 | 2.36E-15 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 5.59E-07 | 6.71E-12 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432443461 | 6.05E-07 | NA | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |