Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0432443461:

Variant ID: vg0432443461 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32443461
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACATACATCTGACAGGGGATGAACCGGGACTAAAAATCATCTTTAGTCCCGGTTGGTAAAGATCAAAAATTTTTTAACCGGGACTAAAAATCGTTTTTA[G/A]
TCCCGGTTTTTAGTGGAACCGGGACTATTGTGAGATTTGGTCGACCGACCAAAGATGGTTTCTCCACCAGTGGTTTCTTGAGGCGTTCGAGCTGCTCCGC

Reverse complement sequence

GCGGAGCAGCTCGAACGCCTCAAGAAACCACTGGTGGAGAAACCATCTTTGGTCGGTCGACCAAATCTCACAATAGTCCCGGTTCCACTAAAAACCGGGA[C/T]
TAAAAACGATTTTTAGTCCCGGTTAAAAAATTTTTGATCTTTACCAACCGGGACTAAAGATGATTTTTAGTCCCGGTTCATCCCCTGTCAGATGTATGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 16.30% 0.15% 0.00% NA
All Indica  2759 81.80% 18.10% 0.11% 0.00% NA
All Japonica  1512 93.70% 6.30% 0.07% 0.00% NA
Aus  269 36.40% 62.50% 1.12% 0.00% NA
Indica I  595 92.80% 7.20% 0.00% 0.00% NA
Indica II  465 85.60% 14.00% 0.43% 0.00% NA
Indica III  913 69.30% 30.60% 0.11% 0.00% NA
Indica Intermediate  786 85.60% 14.40% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 81.70% 18.30% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432443461 G -> A LOC_Os04g54540.1 upstream_gene_variant ; 3983.0bp to feature; MODIFIER silent_mutation Average:54.622; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0432443461 G -> A LOC_Os04g54550.1 downstream_gene_variant ; 1937.0bp to feature; MODIFIER silent_mutation Average:54.622; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0432443461 G -> A LOC_Os04g54540-LOC_Os04g54550 intergenic_region ; MODIFIER silent_mutation Average:54.622; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432443461 NA 4.92E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 7.75E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 1.97E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 5.34E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 2.60E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 7.75E-06 5.32E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 2.45E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 3.55E-07 1.25E-11 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 2.61E-08 1.81E-10 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 9.80E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 6.04E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 3.74E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 6.28E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 4.91E-08 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 1.48E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 2.13E-07 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 9.00E-06 1.66E-08 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 NA 2.84E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 1.63E-06 3.98E-10 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 5.46E-10 2.11E-16 mr1741_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 8.09E-08 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 1.00E-07 8.91E-10 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 6.09E-18 7.46E-28 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 8.50E-14 2.36E-15 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 5.59E-07 6.71E-12 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443461 6.05E-07 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251