Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432437759:

Variant ID: vg0432437759 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32437759
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAAAAGACGTGGTTATAAGGCAGGAGTCGAATGTTTCATCTGCCATGGGATGGGACACTATTCATGGTGCTGCCCTCAGAAAGTCAAGTCAAAACGAG[T/C]
CCAACCAACAACAAGCCTTCCCAACGTATCTGGACCAAAGAGTTCAAAGTCACCAAACAGTGGTTCTGCCTCGTTGACCTCACCGCCCGTCGGACAAGGT

Reverse complement sequence

ACCTTGTCCGACGGGCGGTGAGGTCAACGAGGCAGAACCACTGTTTGGTGACTTTGAACTCTTTGGTCCAGATACGTTGGGAAGGCTTGTTGTTGGTTGG[A/G]
CTCGTTTTGACTTGACTTTCTGAGGGCAGCACCATGAATAGTGTCCCATCCCATGGCAGATGAAACATTCGACTCCTGCCTTATAACCACGTCTTTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.40%	5.20%	9.71%	36.61%	NA
All Indica	2759	25.60%	8.70%	14.64%	51.11%	NA
All Japonica	1512	82.00%	0.20%	2.31%	15.48%	NA
Aus	269	78.80%	0.00%	3.35%	17.84%	NA
Indica I	595	19.20%	22.40%	7.39%	51.09%	NA
Indica II	465	19.40%	14.40%	24.73%	41.51%	NA
Indica III	913	31.00%	0.10%	15.22%	53.67%	NA
Indica Intermediate	786	27.70%	5.00%	13.49%	53.82%	NA
Temperate Japonica	767	84.20%	0.30%	1.30%	14.21%	NA
Tropical Japonica	504	81.70%	0.20%	3.77%	14.29%	NA
Japonica Intermediate	241	75.50%	0.00%	2.49%	21.99%	NA
VI/Aromatic	96	81.20%	0.00%	3.12%	15.62%	NA
Intermediate	90	60.00%	5.60%	8.89%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432437759	T -> C	LOC_Os04g54530.1	downstream_gene_variant ; 207.0bp to feature; MODIFIER	silent_mutation	Average:7.917; most accessible tissue: Callus, score: 25.23	N	N	N	N
vg0432437759	T -> C	LOC_Os04g54540.1	downstream_gene_variant ; 824.0bp to feature; MODIFIER	silent_mutation	Average:7.917; most accessible tissue: Callus, score: 25.23	N	N	N	N
vg0432437759	T -> C	LOC_Os04g54530-LOC_Os04g54540	intergenic_region ; MODIFIER	silent_mutation	Average:7.917; most accessible tissue: Callus, score: 25.23	N	N	N	N
vg0432437759	T -> DEL	N	N	silent_mutation	Average:7.917; most accessible tissue: Callus, score: 25.23	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432437759	NA	3.64E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	2.93E-06	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	1.11E-06	mr1530	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	6.07E-11	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	2.66E-07	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	4.42E-10	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	2.18E-10	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	3.40E-08	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	9.85E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	1.67E-08	6.23E-21	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	1.84E-08	1.67E-13	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	1.51E-08	mr1530_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	3.50E-07	1.30E-14	mr1662_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	7.05E-08	7.99E-15	mr1662_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759	NA	1.94E-11	mr1745_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251