\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432437759:

Variant ID: vg0432437759 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32437759
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAAAAGACGTGGTTATAAGGCAGGAGTCGAATGTTTCATCTGCCATGGGATGGGACACTATTCATGGTGCTGCCCTCAGAAAGTCAAGTCAAAACGAG[T/C]
CCAACCAACAACAAGCCTTCCCAACGTATCTGGACCAAAGAGTTCAAAGTCACCAAACAGTGGTTCTGCCTCGTTGACCTCACCGCCCGTCGGACAAGGT

Reverse complement sequence

ACCTTGTCCGACGGGCGGTGAGGTCAACGAGGCAGAACCACTGTTTGGTGACTTTGAACTCTTTGGTCCAGATACGTTGGGAAGGCTTGTTGTTGGTTGG[A/G]
CTCGTTTTGACTTGACTTTCTGAGGGCAGCACCATGAATAGTGTCCCATCCCATGGCAGATGAAACATTCGACTCCTGCCTTATAACCACGTCTTTTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 5.20% 9.71% 36.61% NA
All Indica  2759 25.60% 8.70% 14.64% 51.11% NA
All Japonica  1512 82.00% 0.20% 2.31% 15.48% NA
Aus  269 78.80% 0.00% 3.35% 17.84% NA
Indica I  595 19.20% 22.40% 7.39% 51.09% NA
Indica II  465 19.40% 14.40% 24.73% 41.51% NA
Indica III  913 31.00% 0.10% 15.22% 53.67% NA
Indica Intermediate  786 27.70% 5.00% 13.49% 53.82% NA
Temperate Japonica  767 84.20% 0.30% 1.30% 14.21% NA
Tropical Japonica  504 81.70% 0.20% 3.77% 14.29% NA
Japonica Intermediate  241 75.50% 0.00% 2.49% 21.99% NA
VI/Aromatic  96 81.20% 0.00% 3.12% 15.62% NA
Intermediate  90 60.00% 5.60% 8.89% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432437759 T -> C LOC_Os04g54530.1 downstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:7.917; most accessible tissue: Callus, score: 25.23 N N N N
vg0432437759 T -> C LOC_Os04g54540.1 downstream_gene_variant ; 824.0bp to feature; MODIFIER silent_mutation Average:7.917; most accessible tissue: Callus, score: 25.23 N N N N
vg0432437759 T -> C LOC_Os04g54530-LOC_Os04g54540 intergenic_region ; MODIFIER silent_mutation Average:7.917; most accessible tissue: Callus, score: 25.23 N N N N
vg0432437759 T -> DEL N N silent_mutation Average:7.917; most accessible tissue: Callus, score: 25.23 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432437759 NA 3.64E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 2.93E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 1.11E-06 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 6.07E-11 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 2.66E-07 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 4.42E-10 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 2.18E-10 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 3.40E-08 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 9.85E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 1.67E-08 6.23E-21 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 1.84E-08 1.67E-13 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 1.51E-08 mr1530_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 3.50E-07 1.30E-14 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 7.05E-08 7.99E-15 mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432437759 NA 1.94E-11 mr1745_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251