\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432427528:

Variant ID: vg0432427528 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32427528
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCCGCCTCCCCGCGCGCGGCCGCGCCGTCGCCACCCGCCGCCCGCCTCCCCGCCGCCGGCCGGCTGATGGAAGAGGGAGTTGAGGGGAAGAGGAAGGG[C/T]
CGGCTGATGGGAGGGAGGAGAGGGGAGGAGGAGAAGAGGAAGGGGAGGAGGAGAAGAGAGGGGATGGGAGGAGGAAGAGGATTGGATCTGAGAAGAGGAA

Reverse complement sequence

TTCCTCTTCTCAGATCCAATCCTCTTCCTCCTCCCATCCCCTCTCTTCTCCTCCTCCCCTTCCTCTTCTCCTCCTCCCCTCTCCTCCCTCCCATCAGCCG[G/A]
CCCTTCCTCTTCCCCTCAACTCCCTCTTCCATCAGCCGGCCGGCGGCGGGGAGGCGGGCGGCGGGTGGCGACGGCGCGGCCGCGCGCGGGGAGGCGGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 3.70% 6.01% 6.37% NA
All Indica  2759 81.90% 3.80% 6.16% 8.05% NA
All Japonica  1512 93.80% 0.50% 1.59% 4.17% NA
Aus  269 39.00% 23.40% 32.71% 4.83% NA
Indica I  595 92.30% 1.30% 1.34% 5.04% NA
Indica II  465 86.20% 1.70% 7.96% 4.09% NA
Indica III  913 69.60% 8.40% 8.65% 13.36% NA
Indica Intermediate  786 86.00% 1.70% 5.85% 6.49% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 82.10% 1.40% 4.37% 12.10% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 94.40% 1.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432427528 C -> DEL N N silent_mutation Average:63.688; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0432427528 C -> T LOC_Os04g54510.1 upstream_gene_variant ; 1910.0bp to feature; MODIFIER silent_mutation Average:63.688; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0432427528 C -> T LOC_Os04g54500.1 downstream_gene_variant ; 3531.0bp to feature; MODIFIER silent_mutation Average:63.688; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0432427528 C -> T LOC_Os04g54520.1 downstream_gene_variant ; 2501.0bp to feature; MODIFIER silent_mutation Average:63.688; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0432427528 C -> T LOC_Os04g54510-LOC_Os04g54520 intergenic_region ; MODIFIER silent_mutation Average:63.688; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432427528 3.31E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 2.01E-06 4.61E-08 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 5.36E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 2.50E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 1.94E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 4.65E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 7.23E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 4.47E-06 1.27E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 1.07E-07 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 5.81E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 3.11E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 1.93E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 2.36E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 5.47E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 5.07E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 2.45E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 5.32E-07 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 2.55E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 8.30E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 1.44E-08 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 3.51E-06 2.62E-08 mr1949 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 8.15E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 6.52E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 5.46E-06 2.26E-08 mr1638_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 1.10E-06 1.14E-08 mr1729_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 NA 6.72E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 1.60E-06 2.24E-09 mr1740_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 1.35E-08 7.87E-13 mr1741_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 5.10E-06 NA mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 3.50E-08 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 3.65E-08 8.76E-10 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 4.11E-15 1.22E-22 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 1.66E-07 4.28E-10 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 4.28E-09 1.23E-14 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432427528 5.17E-06 NA mr1804_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251