\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432426919:

Variant ID: vg0432426919 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32426919
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CAGACCGTCGCGACGAGGGCGACGAAGCTGGACGGTGGCCGACGCGGTGGTGCGCCGTGGGCTTCGCCGTCTCGGACGATGCGTTCACTGGTGAAAAAAT[A/G,T]
TTTTTTACTCCCGGTTTAGAACCTCACTACGAATCCGGGACTAAAAATCGATAAGATGGAGGAGTAAAGAGAGGGAATCTTTAGTCCCGGTTGGTGGGAA

Reverse complement sequence

TTCCCACCAACCGGGACTAAAGATTCCCTCTCTTTACTCCTCCATCTTATCGATTTTTAGTCCCGGATTCGTAGTGAGGTTCTAAACCGGGAGTAAAAAA[T/C,A]
ATTTTTTCACCAGTGAACGCATCGTCCGAGACGGCGAAGCCCACGGCGCACCACCGCGTCGGCCACCGTCCAGCTTCGTCGCCCTCGTCGCGACGGTCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.70% 0.04% 0.00% T: 0.04%
All Indica  2759 71.80% 28.20% 0.04% 0.00% NA
All Japonica  1512 93.20% 6.70% 0.07% 0.00% NA
Aus  269 24.20% 75.10% 0.00% 0.00% T: 0.74%
Indica I  595 92.10% 7.70% 0.17% 0.00% NA
Indica II  465 75.50% 24.50% 0.00% 0.00% NA
Indica III  913 51.20% 48.80% 0.00% 0.00% NA
Indica Intermediate  786 78.10% 21.90% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 18.50% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432426919 A -> G LOC_Os04g54510.1 upstream_gene_variant ; 1301.0bp to feature; MODIFIER silent_mutation Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0432426919 A -> G LOC_Os04g54500.1 downstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0432426919 A -> G LOC_Os04g54520.1 downstream_gene_variant ; 3110.0bp to feature; MODIFIER silent_mutation Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0432426919 A -> G LOC_Os04g54510-LOC_Os04g54520 intergenic_region ; MODIFIER silent_mutation Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0432426919 A -> T LOC_Os04g54510.1 upstream_gene_variant ; 1301.0bp to feature; MODIFIER silent_mutation Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0432426919 A -> T LOC_Os04g54500.1 downstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0432426919 A -> T LOC_Os04g54520.1 downstream_gene_variant ; 3110.0bp to feature; MODIFIER silent_mutation Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0432426919 A -> T LOC_Os04g54510-LOC_Os04g54520 intergenic_region ; MODIFIER silent_mutation Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432426919 NA 4.92E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 7.75E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 5.98E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 5.34E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 2.60E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 3.58E-06 2.66E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 5.17E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 1.69E-11 4.56E-16 mr1800 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 1.12E-09 2.15E-11 mr1800 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 1.17E-06 NA mr1862 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 9.80E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 3.74E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 2.39E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 6.54E-08 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 2.09E-08 1.46E-15 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 8.71E-06 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 NA 1.01E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 2.78E-16 7.51E-28 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 2.28E-11 2.93E-13 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 5.59E-07 6.71E-12 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919 3.32E-06 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251