\
| Variant ID: vg0432426919 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32426919 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.12, others allele: 0.00, population size: 103. )
CAGACCGTCGCGACGAGGGCGACGAAGCTGGACGGTGGCCGACGCGGTGGTGCGCCGTGGGCTTCGCCGTCTCGGACGATGCGTTCACTGGTGAAAAAAT[A/G,T]
TTTTTTACTCCCGGTTTAGAACCTCACTACGAATCCGGGACTAAAAATCGATAAGATGGAGGAGTAAAGAGAGGGAATCTTTAGTCCCGGTTGGTGGGAA
TTCCCACCAACCGGGACTAAAGATTCCCTCTCTTTACTCCTCCATCTTATCGATTTTTAGTCCCGGATTCGTAGTGAGGTTCTAAACCGGGAGTAAAAAA[T/C,A]
ATTTTTTCACCAGTGAACGCATCGTCCGAGACGGCGAAGCCCACGGCGCACCACCGCGTCGGCCACCGTCCAGCTTCGTCGCCCTCGTCGCGACGGTCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.20% | 24.70% | 0.04% | 0.00% | T: 0.04% |
| All Indica | 2759 | 71.80% | 28.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 93.20% | 6.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 24.20% | 75.10% | 0.00% | 0.00% | T: 0.74% |
| Indica I | 595 | 92.10% | 7.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 51.20% | 48.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.50% | 18.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432426919 | A -> G | LOC_Os04g54510.1 | upstream_gene_variant ; 1301.0bp to feature; MODIFIER | silent_mutation | Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0432426919 | A -> G | LOC_Os04g54500.1 | downstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0432426919 | A -> G | LOC_Os04g54520.1 | downstream_gene_variant ; 3110.0bp to feature; MODIFIER | silent_mutation | Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0432426919 | A -> G | LOC_Os04g54510-LOC_Os04g54520 | intergenic_region ; MODIFIER | silent_mutation | Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0432426919 | A -> T | LOC_Os04g54510.1 | upstream_gene_variant ; 1301.0bp to feature; MODIFIER | silent_mutation | Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0432426919 | A -> T | LOC_Os04g54500.1 | downstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0432426919 | A -> T | LOC_Os04g54520.1 | downstream_gene_variant ; 3110.0bp to feature; MODIFIER | silent_mutation | Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0432426919 | A -> T | LOC_Os04g54510-LOC_Os04g54520 | intergenic_region ; MODIFIER | silent_mutation | Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432426919 | NA | 4.92E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 7.75E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 5.98E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 5.34E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 2.60E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 3.58E-06 | 2.66E-10 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 5.17E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 1.69E-11 | 4.56E-16 | mr1800 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 1.12E-09 | 2.15E-11 | mr1800 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 1.17E-06 | NA | mr1862 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 9.80E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 3.74E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 2.39E-06 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 6.54E-08 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 2.09E-08 | 1.46E-15 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 8.71E-06 | NA | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | NA | 1.01E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 2.78E-16 | 7.51E-28 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 2.28E-11 | 2.93E-13 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 5.59E-07 | 6.71E-12 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432426919 | 3.32E-06 | NA | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |