Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432413980:

Variant ID: vg0432413980 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32413980
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTAGTCACCCCCCACTTCCTCCGCAGAAGCCAGCGCGAGACCAGACGGCAGAAGACTGCCGCAGAATTTGCCGCCCGGCCGCGCGCAGCGGGCAGGCA[G/A]
CGGCGCACAGGCAGCTGGTCTCGTCTGCGTCTCACGCTGATCTCATGCCGTGACGAGCTGACTAGAGCTGAGCTACACGACAGGCGGAGCTCTCATGCGT

Reverse complement sequence

ACGCATGAGAGCTCCGCCTGTCGTGTAGCTCAGCTCTAGTCAGCTCGTCACGGCATGAGATCAGCGTGAGACGCAGACGAGACCAGCTGCCTGTGCGCCG[C/T]
TGCCTGCCCGCTGCGCGCGGCCGGGCGGCAAATTCTGCGGCAGTCTTCTGCCGTCTGGTCTCGCGCTGGCTTCTGCGGAGGAAGTGGGGGGTGACTAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 17.30% 0.02% 0.00% NA
All Indica  2759 80.10% 19.90% 0.04% 0.00% NA
All Japonica  1512 93.70% 6.30% 0.00% 0.00% NA
Aus  269 38.70% 61.30% 0.00% 0.00% NA
Indica I  595 90.80% 9.20% 0.00% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 67.00% 33.00% 0.00% 0.00% NA
Indica Intermediate  786 84.20% 15.60% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 81.70% 18.30% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432413980 G -> A LOC_Os04g54490.1 upstream_gene_variant ; 800.0bp to feature; MODIFIER silent_mutation Average:96.04; most accessible tissue: Zhenshan97 flower, score: 97.646 N N N N
vg0432413980 G -> A LOC_Os04g54500.1 upstream_gene_variant ; 4383.0bp to feature; MODIFIER silent_mutation Average:96.04; most accessible tissue: Zhenshan97 flower, score: 97.646 N N N N
vg0432413980 G -> A LOC_Os04g54474.1 downstream_gene_variant ; 1915.0bp to feature; MODIFIER silent_mutation Average:96.04; most accessible tissue: Zhenshan97 flower, score: 97.646 N N N N
vg0432413980 G -> A LOC_Os04g54474.2 downstream_gene_variant ; 1915.0bp to feature; MODIFIER silent_mutation Average:96.04; most accessible tissue: Zhenshan97 flower, score: 97.646 N N N N
vg0432413980 G -> A LOC_Os04g54474.3 downstream_gene_variant ; 1915.0bp to feature; MODIFIER silent_mutation Average:96.04; most accessible tissue: Zhenshan97 flower, score: 97.646 N N N N
vg0432413980 G -> A LOC_Os04g54474-LOC_Os04g54490 intergenic_region ; MODIFIER silent_mutation Average:96.04; most accessible tissue: Zhenshan97 flower, score: 97.646 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432413980 G A 0.03 -0.02 -0.02 0.01 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432413980 1.29E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 NA 9.09E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 NA 6.69E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 NA 3.87E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 NA 3.67E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 7.26E-07 3.69E-09 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 1.59E-08 8.29E-13 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 4.13E-09 5.52E-11 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 2.33E-06 2.33E-06 mr1862 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 NA 9.42E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 NA 8.98E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 NA 8.34E-07 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 NA 4.08E-07 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 7.30E-06 7.06E-09 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 6.59E-09 1.72E-14 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 8.33E-07 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 1.27E-06 1.34E-08 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 5.60E-16 5.62E-25 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 1.07E-12 4.42E-14 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 6.10E-06 5.46E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432413980 1.91E-07 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251