\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432402949:

Variant ID: vg0432402949 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32402949
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAAGTTGTACTACTAGATTCCAAAACCACTTTGCAAATTAATTCAAGGAACAATTTTTCCCATGAGCAAGTTTAATAGTATAGCCAACTACTAGTGC[C/T]
AATTTATCTATAGCCAATCTAGTAGCTCATTCATACAATAGTTACATACTACACTATTAATACATGGTCCACCTGTCATACACACACCGCGTCTTGGAGT

Reverse complement sequence

ACTCCAAGACGCGGTGTGTGTATGACAGGTGGACCATGTATTAATAGTGTAGTATGTAACTATTGTATGAATGAGCTACTAGATTGGCTATAGATAAATT[G/A]
GCACTAGTAGTTGGCTATACTATTAAACTTGCTCATGGGAAAAATTGTTCCTTGAATTAATTTGCAAAGTGGTTTTGGAATCTAGTAGTACAACTTTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 24.30% 0.06% 0.00% NA
All Indica  2759 76.70% 23.30% 0.04% 0.00% NA
All Japonica  1512 82.70% 17.30% 0.07% 0.00% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 90.60% 9.40% 0.00% 0.00% NA
Indica II  465 82.60% 17.40% 0.00% 0.00% NA
Indica III  913 61.70% 38.30% 0.00% 0.00% NA
Indica Intermediate  786 80.20% 19.70% 0.13% 0.00% NA
Temperate Japonica  767 96.20% 3.70% 0.13% 0.00% NA
Tropical Japonica  504 77.40% 22.60% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432402949 C -> T LOC_Os04g54474.1 upstream_gene_variant ; 387.0bp to feature; MODIFIER silent_mutation Average:77.534; most accessible tissue: Callus, score: 93.924 N N N N
vg0432402949 C -> T LOC_Os04g54474.2 upstream_gene_variant ; 2640.0bp to feature; MODIFIER silent_mutation Average:77.534; most accessible tissue: Callus, score: 93.924 N N N N
vg0432402949 C -> T LOC_Os04g54450.1 downstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:77.534; most accessible tissue: Callus, score: 93.924 N N N N
vg0432402949 C -> T LOC_Os04g54460.1 downstream_gene_variant ; 1159.0bp to feature; MODIFIER silent_mutation Average:77.534; most accessible tissue: Callus, score: 93.924 N N N N
vg0432402949 C -> T LOC_Os04g54460-LOC_Os04g54474 intergenic_region ; MODIFIER silent_mutation Average:77.534; most accessible tissue: Callus, score: 93.924 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432402949 C T 0.04 0.02 0.0 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432402949 NA 9.56E-06 Grain_weight Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0432402949 8.78E-08 3.04E-12 mr1403 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402949 1.44E-06 1.44E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402949 1.16E-06 8.44E-10 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402949 5.79E-09 1.92E-10 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402949 NA 5.33E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402949 3.16E-06 3.41E-11 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402949 5.12E-08 4.58E-14 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402949 1.05E-09 3.25E-11 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251