Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432402938:

Variant ID: vg0432402938 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32402938
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

AGCAAAAACAATAAAAAGTTGTACTACTAGATTCCAAAACCACTTTGCAAATTAATTCAAGGAACAATTTTTCCCATGAGCAAGTTTAATAGTATAGCCA[A/G]
CTACTAGTGCCAATTTATCTATAGCCAATCTAGTAGCTCATTCATACAATAGTTACATACTACACTATTAATACATGGTCCACCTGTCATACACACACCG

Reverse complement sequence

CGGTGTGTGTATGACAGGTGGACCATGTATTAATAGTGTAGTATGTAACTATTGTATGAATGAGCTACTAGATTGGCTATAGATAAATTGGCACTAGTAG[T/C]
TGGCTATACTATTAAACTTGCTCATGGGAAAAATTGTTCCTTGAATTAATTTGCAAAGTGGTTTTGGAATCTAGTAGTACAACTTTTTATTGTTTTTGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	21.20%	0.06%	0.00%	NA
All Indica	2759	79.90%	20.10%	0.04%	0.00%	NA
All Japonica	1512	82.70%	17.30%	0.07%	0.00%	NA
Aus	269	38.70%	61.30%	0.00%	0.00%	NA
Indica I	595	90.60%	9.40%	0.00%	0.00%	NA
Indica II	465	84.70%	15.30%	0.00%	0.00%	NA
Indica III	913	66.90%	33.10%	0.00%	0.00%	NA
Indica Intermediate	786	84.00%	15.90%	0.13%	0.00%	NA
Temperate Japonica	767	96.10%	3.80%	0.13%	0.00%	NA
Tropical Japonica	504	77.40%	22.60%	0.00%	0.00%	NA
Japonica Intermediate	241	51.00%	49.00%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432402938	A -> G	LOC_Os04g54474.1	upstream_gene_variant ; 398.0bp to feature; MODIFIER	silent_mutation	Average:77.046; most accessible tissue: Callus, score: 93.924	N	N	N	N
vg0432402938	A -> G	LOC_Os04g54474.2	upstream_gene_variant ; 2651.0bp to feature; MODIFIER	silent_mutation	Average:77.046; most accessible tissue: Callus, score: 93.924	N	N	N	N
vg0432402938	A -> G	LOC_Os04g54450.1	downstream_gene_variant ; 3826.0bp to feature; MODIFIER	silent_mutation	Average:77.046; most accessible tissue: Callus, score: 93.924	N	N	N	N
vg0432402938	A -> G	LOC_Os04g54460.1	downstream_gene_variant ; 1148.0bp to feature; MODIFIER	silent_mutation	Average:77.046; most accessible tissue: Callus, score: 93.924	N	N	N	N
vg0432402938	A -> G	LOC_Os04g54460-LOC_Os04g54474	intergenic_region ; MODIFIER	silent_mutation	Average:77.046; most accessible tissue: Callus, score: 93.924	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0432402938	A	G	-0.01	-0.01	-0.01	-0.01	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432402938	NA	7.81E-06	Grain_weight	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0432402938	1.10E-06	1.63E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	1.40E-06	9.87E-09	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	4.55E-06	6.87E-09	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	5.33E-09	8.57E-11	mr1800	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	1.98E-06	1.98E-06	mr1862	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	NA	5.72E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	NA	8.35E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	NA	3.56E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	5.37E-06	5.41E-10	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	1.03E-08	1.00E-13	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432402938	1.10E-10	1.54E-12	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251