RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0432345183:

Variant ID: vg0432345183 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32345183
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGGCCCTTTCACTATGCTGAGGTATGATACCCCTCATTTCATGCTTATTTCAGTGCTTGGGTCTCACTGTCCTAATATATAGGTTGTGTTAAAAGATG[A/G]
AGTGGATGTTGATCCCAATGATCAGGCCTCTGTTCTTGAACATTTGGATAAAATTGTGAGTTTTCAGTTTTCCATGATTTGTTATAATCTTTTCCATTTT

Reverse complement sequence

AAAATGGAAAAGATTATAACAAATCATGGAAAACTGAAAACTCACAATTTTATCCAAATGTTCAAGAACAGAGGCCTGATCATTGGGATCAACATCCACT[T/C]
CATCTTTTAACACAACCTATATATTAGGACAGTGAGACCCAAGCACTGAAATAAGCATGAAATGAGGGGTATCATACCTCAGCATAGTGAAAGGGCCTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.60%	0.80%	0.59%	0.00%	NA
All Indica	2759	99.40%	0.40%	0.22%	0.00%	NA
All Japonica	1512	96.80%	1.90%	1.39%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.50%	1.50%	1.01%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	93.90%	3.50%	2.61%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432345183	A -> G	LOC_Os04g54340.1	missense_variant ; p.Glu320Gly; MODERATE	nonsynonymous_codon ; E320G	Average:43.727; most accessible tissue: Callus, score: 70.89	possibly damaging	1.621	TOLERATED	0.35

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432345183	8.49E-06	8.49E-06	mr1099	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	2.02E-07	2.20E-07	mr1113	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	3.51E-08	2.99E-07	mr1114	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	8.43E-08	5.25E-07	mr1116	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	5.56E-08	6.78E-08	mr1117	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	7.36E-08	8.89E-07	mr1118	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	1.89E-07	1.41E-07	mr1123	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	2.58E-06	NA	mr1124	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	2.46E-06	4.97E-07	mr1149	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432345183	1.07E-08	8.45E-09	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 26 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0432345183:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact