\
| Variant ID: vg0432306627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32306627 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )
ATTATCTATTTGAGGCTGTTGTAGCTCCTCCTCTGGTGTGGCAACCATTTCTGTTGAATCCTGTATAACAGGTTCCTCACTCTCATTCATTGTTGCCACA[G/A]
GAGGGGTAACAACAGGTGCTTGTCGGTGATATGGGACCGGGAGTATCATGACTAGAGGCTTGAGGCAGACACAATCGCCCACGTGGCCTGGCACCTTCGG
CCGAAGGTGCCAGGCCACGTGGGCGATTGTGTCTGCCTCAAGCCTCTAGTCATGATACTCCCGGTCCCATATCACCGACAAGCACCTGTTGTTACCCCTC[C/T]
TGTGGCAACAATGAATGAGAGTGAGGAACCTGTTATACAGGATTCAACAGAAATGGTTGCCACACCAGAGGAGGAGCTACAACAGCCTCAAATAGATAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 14.80% | 7.70% | 12.04% | 65.38% | NA |
| All Indica | 2759 | 2.80% | 3.90% | 11.27% | 82.02% | NA |
| All Japonica | 1512 | 39.70% | 16.10% | 11.24% | 32.94% | NA |
| Aus | 269 | 0.40% | 0.70% | 16.73% | 82.16% | NA |
| Indica I | 595 | 8.20% | 1.00% | 2.18% | 88.57% | NA |
| Indica II | 465 | 1.50% | 5.40% | 11.40% | 81.72% | NA |
| Indica III | 913 | 0.40% | 3.70% | 18.18% | 77.66% | NA |
| Indica Intermediate | 786 | 2.30% | 5.30% | 10.05% | 82.32% | NA |
| Temperate Japonica | 767 | 70.90% | 2.30% | 4.17% | 22.56% | NA |
| Tropical Japonica | 504 | 2.40% | 42.70% | 17.06% | 37.90% | NA |
| Japonica Intermediate | 241 | 18.30% | 4.60% | 21.58% | 55.60% | NA |
| VI/Aromatic | 96 | 8.30% | 1.00% | 31.25% | 59.38% | NA |
| Intermediate | 90 | 15.60% | 13.30% | 14.44% | 56.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432306627 | G -> DEL | N | N | silent_mutation | Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0432306627 | G -> A | LOC_Os04g54240.1 | upstream_gene_variant ; 4171.0bp to feature; MODIFIER | silent_mutation | Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0432306627 | G -> A | LOC_Os04g54250.1 | upstream_gene_variant ; 11.0bp to feature; MODIFIER | silent_mutation | Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0432306627 | G -> A | LOC_Os04g54260.1 | upstream_gene_variant ; 1189.0bp to feature; MODIFIER | silent_mutation | Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0432306627 | G -> A | LOC_Os04g54250-LOC_Os04g54260 | intergenic_region ; MODIFIER | silent_mutation | Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432306627 | NA | 3.44E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432306627 | NA | 1.19E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432306627 | NA | 4.19E-08 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432306627 | NA | 4.69E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432306627 | NA | 4.79E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432306627 | 4.53E-06 | 1.67E-08 | mr1596_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432306627 | NA | 3.98E-09 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432306627 | NA | 2.13E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432306627 | NA | 6.27E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |