Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432306627:

Variant ID: vg0432306627 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32306627
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATTATCTATTTGAGGCTGTTGTAGCTCCTCCTCTGGTGTGGCAACCATTTCTGTTGAATCCTGTATAACAGGTTCCTCACTCTCATTCATTGTTGCCACA[G/A]
GAGGGGTAACAACAGGTGCTTGTCGGTGATATGGGACCGGGAGTATCATGACTAGAGGCTTGAGGCAGACACAATCGCCCACGTGGCCTGGCACCTTCGG

Reverse complement sequence

CCGAAGGTGCCAGGCCACGTGGGCGATTGTGTCTGCCTCAAGCCTCTAGTCATGATACTCCCGGTCCCATATCACCGACAAGCACCTGTTGTTACCCCTC[C/T]
TGTGGCAACAATGAATGAGAGTGAGGAACCTGTTATACAGGATTCAACAGAAATGGTTGCCACACCAGAGGAGGAGCTACAACAGCCTCAAATAGATAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	14.80%	7.70%	12.04%	65.38%	NA
All Indica	2759	2.80%	3.90%	11.27%	82.02%	NA
All Japonica	1512	39.70%	16.10%	11.24%	32.94%	NA
Aus	269	0.40%	0.70%	16.73%	82.16%	NA
Indica I	595	8.20%	1.00%	2.18%	88.57%	NA
Indica II	465	1.50%	5.40%	11.40%	81.72%	NA
Indica III	913	0.40%	3.70%	18.18%	77.66%	NA
Indica Intermediate	786	2.30%	5.30%	10.05%	82.32%	NA
Temperate Japonica	767	70.90%	2.30%	4.17%	22.56%	NA
Tropical Japonica	504	2.40%	42.70%	17.06%	37.90%	NA
Japonica Intermediate	241	18.30%	4.60%	21.58%	55.60%	NA
VI/Aromatic	96	8.30%	1.00%	31.25%	59.38%	NA
Intermediate	90	15.60%	13.30%	14.44%	56.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432306627	G -> DEL	N	N	silent_mutation	Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0432306627	G -> A	LOC_Os04g54240.1	upstream_gene_variant ; 4171.0bp to feature; MODIFIER	silent_mutation	Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0432306627	G -> A	LOC_Os04g54250.1	upstream_gene_variant ; 11.0bp to feature; MODIFIER	silent_mutation	Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0432306627	G -> A	LOC_Os04g54260.1	upstream_gene_variant ; 1189.0bp to feature; MODIFIER	silent_mutation	Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0432306627	G -> A	LOC_Os04g54250-LOC_Os04g54260	intergenic_region ; MODIFIER	silent_mutation	Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432306627	NA	3.44E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627	NA	1.19E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627	NA	4.19E-08	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627	NA	4.69E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627	NA	4.79E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627	4.53E-06	1.67E-08	mr1596_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627	NA	3.98E-09	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627	NA	2.13E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627	NA	6.27E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251