\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432306627:

Variant ID: vg0432306627 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32306627
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATCTATTTGAGGCTGTTGTAGCTCCTCCTCTGGTGTGGCAACCATTTCTGTTGAATCCTGTATAACAGGTTCCTCACTCTCATTCATTGTTGCCACA[G/A]
GAGGGGTAACAACAGGTGCTTGTCGGTGATATGGGACCGGGAGTATCATGACTAGAGGCTTGAGGCAGACACAATCGCCCACGTGGCCTGGCACCTTCGG

Reverse complement sequence

CCGAAGGTGCCAGGCCACGTGGGCGATTGTGTCTGCCTCAAGCCTCTAGTCATGATACTCCCGGTCCCATATCACCGACAAGCACCTGTTGTTACCCCTC[C/T]
TGTGGCAACAATGAATGAGAGTGAGGAACCTGTTATACAGGATTCAACAGAAATGGTTGCCACACCAGAGGAGGAGCTACAACAGCCTCAAATAGATAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 14.80% 7.70% 12.04% 65.38% NA
All Indica  2759 2.80% 3.90% 11.27% 82.02% NA
All Japonica  1512 39.70% 16.10% 11.24% 32.94% NA
Aus  269 0.40% 0.70% 16.73% 82.16% NA
Indica I  595 8.20% 1.00% 2.18% 88.57% NA
Indica II  465 1.50% 5.40% 11.40% 81.72% NA
Indica III  913 0.40% 3.70% 18.18% 77.66% NA
Indica Intermediate  786 2.30% 5.30% 10.05% 82.32% NA
Temperate Japonica  767 70.90% 2.30% 4.17% 22.56% NA
Tropical Japonica  504 2.40% 42.70% 17.06% 37.90% NA
Japonica Intermediate  241 18.30% 4.60% 21.58% 55.60% NA
VI/Aromatic  96 8.30% 1.00% 31.25% 59.38% NA
Intermediate  90 15.60% 13.30% 14.44% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432306627 G -> DEL N N silent_mutation Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0432306627 G -> A LOC_Os04g54240.1 upstream_gene_variant ; 4171.0bp to feature; MODIFIER silent_mutation Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0432306627 G -> A LOC_Os04g54250.1 upstream_gene_variant ; 11.0bp to feature; MODIFIER silent_mutation Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0432306627 G -> A LOC_Os04g54260.1 upstream_gene_variant ; 1189.0bp to feature; MODIFIER silent_mutation Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0432306627 G -> A LOC_Os04g54250-LOC_Os04g54260 intergenic_region ; MODIFIER silent_mutation Average:4.652; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432306627 NA 3.44E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627 NA 1.19E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627 NA 4.19E-08 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627 NA 4.69E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627 NA 4.79E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627 4.53E-06 1.67E-08 mr1596_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627 NA 3.98E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627 NA 2.13E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432306627 NA 6.27E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251