Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0432267846:

Variant ID: vg0432267846 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32267846
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTGCTCGTTGTTGATGATCCATAGTCTTCGAGAAGGTGCAAGACTGATGGTTCGTGAGGATCGATATCGATTACCCCAACAAATCGATCTGAAGTTGGC[G/A]
TCGCTCCTCGTTCCTTGTCTTTATCCCTGATGGGGATGTGTGACTGTTGGACCTTAGGAGATGGCGCTTTCATGGTGCTGAGAAAGACCTTGCAACTTGA

Reverse complement sequence

TCAAGTTGCAAGGTCTTTCTCAGCACCATGAAAGCGCCATCTCCTAAGGTCCAACAGTCACACATCCCCATCAGGGATAAAGACAAGGAACGAGGAGCGA[C/T]
GCCAACTTCAGATCGATTTGTTGGGGTAATCGATATCGATCCTCACGAACCATCAGTCTTGCACCTTCTCGAAGACTATGGATCATCAACAACGAGCACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.10%	12.90%	0.00%	0.00%	NA
All Indica	2759	95.70%	4.30%	0.00%	0.00%	NA
All Japonica	1512	82.30%	17.70%	0.00%	0.00%	NA
Aus	269	26.40%	73.60%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	93.80%	6.20%	0.00%	0.00%	NA
Indica III	913	96.70%	3.30%	0.00%	0.00%	NA
Indica Intermediate	786	93.00%	7.00%	0.00%	0.00%	NA
Temperate Japonica	767	97.10%	2.90%	0.00%	0.00%	NA
Tropical Japonica	504	55.20%	44.80%	0.00%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432267846	G -> A	LOC_Os04g54160.1	missense_variant ; p.Thr25Met; MODERATE	nonsynonymous_codon ; T25M	Average:42.282; most accessible tissue: Zhenshan97 root, score: 61.518	benign	1.12	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432267846	NA	3.32E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	6.94E-08	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	6.97E-06	3.36E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	2.48E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	3.19E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	8.81E-09	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	3.60E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	9.73E-07	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	5.24E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	4.62E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	1.58E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	5.87E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	7.32E-07	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	5.11E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	8.62E-06	NA	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	1.23E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	1.08E-07	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	3.22E-07	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	2.09E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	1.18E-07	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	1.96E-08	mr1736_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	3.38E-08	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432267846	NA	3.59E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251